Amaxia apyga

Hampson, 1901 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Amaxia

At a glance

Occurrence records331

Data sources6

Biological traits0

DNA specimens129

eDNA detections120

Sources6 archives

Databases and archives Amaxia apyga's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility331 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI120 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics129 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF331 records

Environmental DNA1 datasets · 2 countries120 detections

DNA & barcodingBOLD129 specimens

01Narrative

Amaxia apyga is a moth of the family Erebidae. It was described by George Hampson in 1901. It is found in Costa Rica.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding129 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amaxia apyga has left across the world's sequence archives.

At a glance

DNA specimens129

BINs3

Marker genes1

eDNA detections120

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus125 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

517Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAACTTGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes6

BINs3

Most divergent pair5.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amaxia rocioecheverriaesame genus5.0%Amaxia consistenssame genus5.3%Amaxia fallaciosasame genus5.5%Vamuna remelanasame family7.9%Trichromia sanguipunctasame family8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type331 records

Wild obs. + sensor13

Museum / vouchered318

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 6≤1 km 1≤10 km 1>10 km 3

11 georeferenced · 2 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 315 without coordinates

Open the institutions mapphysical evidence318

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	287
Mississippi State, US	9
Tapachula, MX	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
University of Pennsylvanialocation not on record	2
Mexico City, MX	2
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	2
Los Angeles, US	1

8 institutions · 307 of 318 vouchered records shown · 11 without an institution code

09Environmental DNA120 detections

Where the DNA of Amaxia apyga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found120

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 120 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.0–25.2

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.1 °C 25.7–27.7

Min temp (night)21.6 °C 20.2–23.5

Precipitation313 mm/mo 195–434

Air humidity70.7 % 68.4–74.7

Moisture balance179 mm/mo 65.8–306

Vapour deficit876 Pa 705–974

Wind speed2.90 m/s 1.40–4.00

Cloud cover38.7 % 30.7–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 119 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)