Amauromyza verbasci

(Bouché, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Amauromyza

At a glance

Occurrence records382

Data sources7

Biological traits0

DNA specimens9

eDNA detections14

Sources7 archives

Databases and archives Amauromyza verbasci's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility382 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF382 records

Environmental DNA3 datasets · 4 countries14 detections

DNA & barcodingBOLD9 specimens

Genome at a glanceTreeOfSex2n = 6

01Narrative

Amauromyza verbasci, la Mouche mineuse du bouillon blanc, est une espèce d'insectes diptères brachycères de la famille des Agromyzidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amauromyza verbasci has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections14

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 5 variable positions, in barcode order

217Tmostly conserved

316Gmostly conserved

346Amostly conserved

370Amostly conserved

403Amostly conserved

AACTTTATATTTTATATTTGGAGCTTGAGCTGGAATAGTAGGAACTTCTTTAAGAATTCTAATTCGATCCGAATTAGGTCACCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Liriomyza bryoniaesame family10.9%Thaumatomyia pullasame order11.0%Hydrotaea irritanssame order11.1%Hydrotaea pandelleisame order11.4%Hydrotaea pellucenssame order11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceTreeOfSex

The complete instruction manual Amauromyza verbasci carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 61×TreeOfSex · invert

TreeOfSex · invert — Block, K. (1977). "Chromosomal variation in Agromyzidae (Diptera)." Hereditas 84(2): 177-210. ↗

08Occurrence & distribution

Record type382 records

Wild obs. + sensor367

Museum / vouchered15

Range

Area of Occupancy AOO1 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 117≤1 km 45≤10 km 180

342 georeferenced · 25 without coordinates

Open the mapobservation + sensor367

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤1 km 5≤10 km 3

8 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	7
SLU Artdatabankenlocation not on record	1

2 institutions · 8 of 15 vouchered records shown · 7 without an institution code

09Environmental DNA14 detections

Where the DNA of Amauromyza verbasci was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys3

Countries4

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map4 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.3 °C 13.1–16.4

Seasonal swing summer↔winter17.5 °C

Max temp (day)17.9 °C 16.9–20.1

Min temp (night)10.8 °C 9.20–13.0

Precipitation68.2 mm/mo 66.0–107

Air humidity63.0 % 59.9–63.3

Moisture balance-15.3 mm/mo -54.3–6.30

Vapour deficit617 Pa 562–726

Wind speed3.30 m/s 2.70–4.10

Cloud cover39.1 % 37.0–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)