Amauromyza shepherdiae

Sehgal, 1971 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Amauromyza

At a glance

Occurrence records16

Data sources6

Biological traits0

DNA specimens14

eDNA detections16

Sources6 archives

Databases and archives Amauromyza shepherdiae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD14 specimens

01Narrative

Amauromyza shepherdiae is een vliegensoort uit de familie van de mineervliegen (Agromyzidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1971 door Sehgal.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amauromyza shepherdiae has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

322Cvariable

TACTTTATATTTTATATTTGGAGCATGAGCTGGAATAACAGGAACTTCATTAAGAATCTTAATTCGAGCTGAATTAGGTCATCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Howickia pseudovittatasame order10.5%Phytomyza cecidonomiasame family11.0%Polyodaspis ruficornissame order11.2%Clytiomya solasame order11.6%Winthemia peruvianasame order11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type16 records

Wild obs. + sensor4

Museum / vouchered12

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8

1 institutions · 8 of 12 vouchered records shown · 4 without an institution code

09Environmental DNA16 detections

Where the DNA of Amauromyza shepherdiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.1 Forest - Boreal1. Forest & Woodland|1.2 Subarctic ForestForestUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 5.80–15.9

Seasonal swing summer↔winter37.2 °C

Max temp (day)14.6 °C 10.0–20.6

Min temp (night)7.10 °C 2.20–10.9

Precipitation55.9 mm/mo 52.3–89.7

Air humidity61.6 % 52.9–64.0

Moisture balance-36.7 mm/mo -70.2–-9.00

Vapour deficit485 Pa 335–839

Wind speed2.70 m/s 2.20–3.70

Cloud cover44.1 % 41.5–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)