Amauromyza labiatarum

(Hendel, 1920) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Amauromyza

At a glance

Occurrence records402

Data sources6

Biological traits0

DNA specimens11

eDNA detections16

Sources6 archives

Databases and archives Amauromyza labiatarum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility402 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF402 records

Environmental DNA3 datasets · 7 countries16 detections

DNA & barcodingBOLD11 specimens

01Narrative

Amauromyza labiatarum is een vliegensoort uit de familie van de mineervliegen (Agromyzidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1920 door Hendel.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amauromyza labiatarum has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections16

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

85Tmostly conserved

346Cvariable

433Gmostly conserved

451Gmostly conserved

466Amostly conserved

550Amostly conserved

577Amostly conserved

643Tmostly conserved

AACTTTATATTTTATATTTGGAGCTTGAGCAGGAATAGTGGGAACTTCTCTAAGAATTTTAATCCGTGCAGAATTAGGACACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes7

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phytomyza ranunculivorasame family11.1%Phytomyza varipessame family12.3%Phytomyza heracleanasame family12.3%Phytomyza erigerophilasame family12.3%Coniosternum decipienssame order12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type402 records

Wild obs. + sensor385

Museum / vouchered17

Range

Area of Occupancy AOO1 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 138≤1 km 80≤10 km 147>10 km 1

366 georeferenced · 19 without coordinates

Open the mapobservation + sensor385

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 2≤10 km 3

5 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	10
Helsinki, FI	2
Naturalis Biodiversity Centerlocation not on record	2
DFFW2018location not on record	1
Oulu, FI	1
NHMOlocation not on record	1

6 institutions · 17 of 17 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Amauromyza labiatarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys3

Countries7

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map7 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 11.5–17.7

Seasonal swing summer↔winter15.3 °C

Max temp (day)19.1 °C 15.0–21.5

Min temp (night)11.5 °C 8.10–13.9

Precipitation67.7 mm/mo 56.1–84.8

Air humidity61.7 % 59.0–62.9

Moisture balance-22.2 mm/mo -64.9–5.10

Vapour deficit690 Pa 493–782

Wind speed3.70 m/s 2.50–4.20

Cloud cover41.3 % 38.3–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)