Amauromyza flavifrons

(Meigen, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Amauromyza

At a glance

Occurrence records766

Data sources9

Biological traits0

DNA specimens32

eDNA detections98

Sources9 archives

Databases and archives Amauromyza flavifrons's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility766 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI98 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF766 records

Environmental DNA4 datasets · 9 countries98 detections

DNA & barcodingBOLD32 specimens

Genome at a glanceGoaT · TreeOfSex2n = 6

01Narrative

Amauromyza flavifrons is a species of leaf miner fly in the family Agromyzidae. It is found in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amauromyza flavifrons has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections98

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

42Cvariable

63Amostly conserved

339Cmostly conserved

429Gmostly conserved

486Tmostly conserved

554Tmostly conserved

TTATATTTTATATTTGGAGCTTGAGCCGGAATAGTAGGAACCTCTCTAAGAATTTTAATTCGAGCTGAATTAGGTCATGCCGGAGCTTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.45%

Haplotypes5

BIN1

Most divergent pair0.77%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phytomyza varipessame family11.7%Rachispoda trigonatasame order11.7%Aphanotrigonum nigripessame order11.8%Agromyza mobilissame family12.0%Nearcticorpus canadensesame order12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Amauromyza flavifrons carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 64×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Block, K. (1977). "Chromosomal variation in Agromyzidae (Diptera)." Hereditas 84(2): 177-210. ↗

08Occurrence & distribution

Record type766 records

Wild obs. + sensor713

Museum / vouchered53

Range

Area of Occupancy AOO2 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 382≤1 km 104≤10 km 128>10 km 11

625 georeferenced · 88 without coordinates

Open the mapobservation + sensor713

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 4≤1 km 5≤10 km 3

12 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	23
University of Guelphlocation not on record	4
Naturalis Biodiversity Centerlocation not on record	4
V. N. Karazin Kharkiv National Universitylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
DFFW2018location not on record	2
Oulu, FI	2
Natural History Museum, Londonlocation not on record	1
NTNU-VMlocation not on record	1

9 institutions · 41 of 53 vouchered records shown · 12 without an institution code

09Environmental DNA98 detections

Where the DNA of Amauromyza flavifrons was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found98

Studies independent surveys4

Countries9

Verifiable raw sequence linked72

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 98 detections have coordinates

Open the map9 countries0

1. Forest & Woodland|1.4. Temperate Forest4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 12.7–17.7

Seasonal swing summer↔winter17.1 °C

Max temp (day)20.1 °C 15.9–22.5

Min temp (night)13.2 °C 10.0–13.7

Precipitation67.9 mm/mo 48.0–92.3

Air humidity61.6 % 57.4–64.4

Moisture balance-38.2 mm/mo -83.1–1.90

Vapour deficit696 Pa 521–844

Wind speed4.10 m/s 2.50–4.70

Cloud cover43.0 % 38.6–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 96 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)