Amaurobioides africana

Hewitt, 1917 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Anyphaenidae/Amaurobioides

At a glance

Occurrence records36

Data sources7

Biological traits26

DNA specimens22

eDNA detections17

Sources7 archives

Databases and archives Amaurobioides africana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

World Spider Trait DBMasaryk University26 traits · 5 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources26 traits

Occurrence & distributionGBIF36 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD22 specimens

01Narrative

Amaurobioides africana is een spinnensoort in de taxonomische indeling van de buisspinnen (Anyphaenidae). Het dier behoort tot het geslacht Amaurobioides. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1917 door J. Hewitt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWolff et al. 2022Pekár 2014aWolff et al. 2013Ramírez 2003Pekár et al. 2012a

Morphometry15

Abdomen length9.44 mm

Abdomen width5.32 mm

Body length14 mm

Cephalothorax length4.92 mm

Cephalothorax width3.6 mm

Claw tuft area0.072 mm

Claw tuft density747 mm

Metatarsus I length2.5 mm

Metatarsus II length2.1 mm

Metatarsus III length2.1 mm

Metatarsus IV length2.33 mm

Tibia I length2.83 mm

Tibia II length2.67 mm

Tibia III length2.37 mm

Tibia IV length2.6 mm

Predation4

Hunting guildground hunters

Hunting guild 2ground runner

Prey diversity1.11 mm

Web buildingno

Ecology4

Circadian activitynocturnal

Microhabitatintertidal rocks

Moisture 2very humid

Stratumground

Biomechanics1

'Primary mode of locomotionwalking

Defence1

Retreatempty shell, under water

Morphology1

Cribellumabsent

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amaurobioides africana has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes3

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P534 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

84Gmostly conserved

87Amostly conserved

99Amostly conserved

108Amostly conserved

177Gvariable

198Gmostly conserved

348Tmostly conserved

354Gvariable

372Avariable

390Amostly conserved

418Gmostly conserved

430Tmostly conserved

471Amostly conserved

TATAATGTAATTGTAACTGCTCATGCTTTTGTTATGATTTTTTTTATAGTAATACCTATTATAATTGGTGGTTTTGGAAATTGGTTATTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes3

BIN1

Most divergent pair0.94%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Axyracrus eleganssame family8.8%Aysenoides parvussame family9.0%Aysenoides colecolesame family9.4%Acanthoceto cinereasame family9.9%Acanthoceto ladormidasame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type36 records

Wild obs. + sensor19

Museum / vouchered17

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 13≤1 km 2

15 georeferenced · 4 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Agricultural Research Council, Plant Protection Research Institute, National Collection of Arachnidalocation not on record	7
Cape Town, ZA	4
Royal Museum for Central Africalocation not on record	2
National Collection of Arachnidalocation not on record	2
University of Guelphlocation not on record	1

5 institutions · 16 of 17 vouchered records shown · 1 without an institution code

09Environmental DNA17 detections

Where the DNA of Amaurobioides africana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 14.5–18.3

Seasonal swing summer↔winter4.80 °C

Max temp (day)18.7 °C 17.3–24.5

Min temp (night)12.2 °C 11.4–13.7

Precipitation10.8 mm/mo 5.70–54.2

Air humidity56.6 % 50.6–62.4

Moisture balance-92.6 mm/mo

Vapour deficit732 Pa 672–1,026

Wind speed4.20 m/s

Cloud cover10.6 % 3.60–14.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)