Amathia alternata

Lamouroux, 1816 · species

image placeholder — illustration coming later

Animalia/Bryozoa/Gymnolaemata/Ctenostomatida/Vesiculariidae/Amathia

At a glance

Occurrence records159

Data sources8

Biological traits2

DNA specimens7

eDNA detections4

Sources8 archives

Databases and archives Amathia alternata's data was compiled from.

GBIFGlobal Biodiversity Information Facility88 records↗

OBISOcean Biodiversity Information System71 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF · OBIS159 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD7 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition24 compounds

Compounds documented for Amathia alternata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids4

Eudesmane sesquiterpenoids3

Flavones2

Simple coumarins1

Cembrane diterpenoids1

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3S,5R,8E,10S,11R)-10-hydroxy-3,8-dimethyl-12-methylidene-4,14-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS
(2S,3R)-3-methyl-2-(methylamino)-N-[2-(2,5,6-tribromo-1H-indol-3-yl)ethyl]pentanamide	present	LOTUS
(2S,3R)-N-[2-(2,5-dibromo-1H-indol-3-yl)ethyl]-3-methyl-2-(methylamino)pentanamide	present	LOTUS
(2S,3S)-3-methyl-2-(methylamino)-N-[2-(2,5,6-tribromo-1-methylindol-3-yl)ethyl]pentanamide	present	LOTUS
(2S,3S)-N-[2-(5,6-dibromo-1H-indol-3-yl)ethyl]-3-methyl-2-(methylamino)pentanamide	present	LOTUS
(3aR,4S,5S,9E,11aR)-4,5-dihydroxy-10-methyl-3,6-dimethylidene-4,5,7,8,11,11a-hexahydro-3aH-cyclodeca[b]furan-2-one	present	NPASS
(3aS,4R,4aS,8R,8aR,9aS)-4,8-dihydroxy-5,8a-dimethyl-3-methylidene-4,4a,7,8,9,9a-hexahydro-3aH-benzo[f][1]benzofuran-2-one	present	NPASS
(3aS,4S,5E,9S,10E,11aS)-9-[[(3R,3aS,4R,5E,9E,11aS)-4-hydroxy-6,10-dimethyl-2-oxo-3a,4,7,8,11,11a-hexahydro-3H-cyclodeca[b]furan-3-yl]methyl]-4-hydroxy-6,10-dimethyl-3-methylidene-3a,4,7,8,9,11a-hexahydrocyclodeca[b]furan-2-one	present	NPASS
(3S,3aS,4R,5E,9E,11aS)-4-hydroxy-3-(hydroxymethyl)-6,10-dimethyl-3a,4,7,8,11,11a-hexahydro-3H-cyclodeca[b]furan-2-one	present	NPASS
2-[(1R,2R,3S,4aR,5R,8aR)-1,3,5-trihydroxy-4a-methyl-8-methylidene-1,2,3,4,5,6,7,8a-octahydronaphthalen-2-yl]prop-2-enal	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amathia alternata has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CACACTTTATTTTTTGTTTGGTCTTTGGGCGGGGATGGTTGGAAGAGGTTTGAGTGCTTTGGTTCGTGTAGAGTTGAGTCAGCCTGGGGG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type159 records

Wild obs. + sensor35

Museum / vouchered124

Range

Area of Occupancy AOO236 km²

Depth

0–200 m sunlit43

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 66.3 m · 43 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 1

10 georeferenced · 25 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 124 records without

Open the institutions mapphysical evidence124

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	28
Washington, US	15
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	5
	1

4 institutions · 49 of 124 vouchered records shown · 25 without an institution code

09Environmental DNA4 detections

Where the DNA of Amathia alternata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.9–25.1

Seasonal swing summer↔winter3.80 °C

Max temp (day)25.6 °C 25.3–26.1

Min temp (night)24.6 °C 24.2–24.6

Precipitation8.40 mm/mo 1.80–10.3

Air humidity69.7 % 67.9–72.0

Vapour deficit969 Pa 891–1,021

Cloud cover12.0 % 11.9–14.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)