Amata passalis

Fabricius, 1781 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Amata

At a glance

Occurrence records2 377

Data sources7

Biological traits0

DNA specimens7

eDNA detections7

Sources7 archives

Databases and archives Amata passalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 377 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 377 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Amata passalis, the sandalwood defoliator, is a moth of the family Erebidae first described by Johan Christian Fabricius in 1781. It is found in Sri Lanka and India.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amata passalis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P626 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.72%

Haplotypes1

BINs2

Where individuals differ — all 8 variable positions, in barcode order

119Cvariable

189Cvariable

212Cvariable

257Avariable

335Cvariable

410Avariable

521Tvariable

539Tvariable

TTTGAGCTGGAATAGTAGGTACCTCATTAAGATTATTAATTCGAGCTGAATTAGGAACTCCAAATTCTTTAATTGGAGATGATCAAATTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amata marellasame genus8.6%Melese chozebasame family8.6%Amata cerberasame genus8.8%Meganaclia sippiasame family8.8%Euchlorostola anusiasame family8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 377 records

Wild obs. + sensor2 374

Museum / vouchered3

Range

Area of Occupancy AOO4 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 727≤1 km 577≤10 km 177>10 km 146

1 627 georeferenced · 747 without coordinates

Open the mapobservation + sensor2 374

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	1
VBUlocation not on record	1

2 institutions · 2 of 3 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Amata passalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Pigeonpea

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 23.8–25.1

Seasonal swing summer↔winter6.10 °C

Max temp (day)27.6 °C 26.9–28.3

Min temp (night)20.9 °C 19.1–22.8

Precipitation120 mm/mo 81.4–159

Air humidity59.2 % 58.3–60.1

Moisture balance-25.9 mm/mo -57.7–6.00

Vapour deficit1,256 Pa 1,243–1,268

Wind speed3.60 m/s 3.00–4.30

Cloud cover22.6 % 16.5–28.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amata passalis

At a glance

Sources7 archives

At a glance

Record type2 377 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 2 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 377 records