Amata aperta

Walker · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Amata

At a glance

Occurrence records544

Data sources6

Biological traits0

DNA specimens42

eDNA detections46

Sources6 archives

Databases and archives Amata aperta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility544 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF544 records

Environmental DNA1 datasets · 1 countries46 detections

DNA & barcodingBOLD42 specimens

01Narrative

Amata nesothetis is een beervlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1886 door Meyrick.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amata aperta has left across the world's sequence archives.

At a glance

DNA specimens42

BINs2

Marker genes1

eDNA detections46

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

178Tmostly conserved

190Amostly conserved

206Tmostly conserved

220Tmostly conserved

235Tvariable

250Tmostly conserved

373Tmostly conserved

401Cmostly conserved

433Cmostly conserved

436Cmostly conserved

460Cvariable

517Amostly conserved

532Cmostly conserved

628Amostly conserved

AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGAACTCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.74%

Haplotypes15

BINs2

Most divergent pair2.1%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amata pactolinasame genus1.7%Amata humeralissame genus4.9%Amata paraulasame genus5.2%Amata marellasame genus5.2%Amata nigricepssame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type544 records

Wild obs. + sensor494

Museum / vouchered50

Range

Area of Occupancy AOO1 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 234≤1 km 58≤10 km 31>10 km 62

385 georeferenced · 109 without coordinates

Open the mapobservation + sensor494

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 7

7 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	19
Tallinn, EE	14
Sydney, AU	7
DPIlocation not on record	6
Australian National Insect Collectionlocation not on record	1
Western Australian Museumlocation not on record	1

6 institutions · 48 of 50 vouchered records shown · 2 without an institution code

09Environmental DNA46 detections

Where the DNA of Amata aperta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 20.1–25.5

Seasonal swing summer↔winter12.8 °C

Max temp (day)26.7 °C 24.5–30.4

Min temp (night)19.7 °C 12.8–22.1

Precipitation80.3 mm/mo 19.5–179

Air humidity58.2 % 46.7–62.0

Moisture balance-76.8 mm/mo

Vapour deficit1,110 Pa 1,014–1,541

Wind speed3.80 m/s

Cloud cover26.0 % 16.0–33.9

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)