Amaralia oviraptor

Friel & Carvalho, 2016 · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Aspredinidae/Amaralia

At a glance

Occurrence records24

Data sources6

Biological traits4

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Amaralia oviraptor's data was compiled from.

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF24 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD3 specimens

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length12.28 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amaralia oviraptor has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P672 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.35%

Haplotypes2

BIN1

Most divergent pair0.45%

Where individuals differ — all 3 variable positions, in barcode order

57Avariable

135Avariable

327Gvariable

ATTGGCACCCTGTATTTAGTATTTGGTGCCTGAGCCGGTATAATCGGCACAGCCCTAAGCCTACTAATTCGAGCAGAGTTAGCCCAACCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amaralia hypsiurasame genus7.6%Bunocephalus coracoideussame family12.8%Bunocephalus amaurussame family13.1%Bunocephalus verrucosussame family13.4%Bunocephalus aloikaesame family13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type24 records

Wild obs. + sensor2

Museum / vouchered22

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museu de Zoologia da Universidade de Sao Paulolocation not on record	5
UEMlocation not on record	5
Ann Arbor, US	3
MPSlocation not on record	3
Stockholm, SE	3
UFMSlocation not on record	2
UNEMATlocation not on record	1

7 institutions · 22 of 22 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Amaralia oviraptor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)