Amara scitula

Zimmermann, 1832 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records263

Data sources7

Biological traits0

DNA specimens29

eDNA detections20

Sources7 archives

Databases and archives Amara scitula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility263 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF263 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD29 specimens

01Narrative

Amara scitula is a species of seed-eating ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara scitula has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

34Amostly conserved

55Amostly conserved

59Cmostly conserved

73Gmostly conserved

106Cmostly conserved

178Tmostly conserved

181Gmostly conserved

226Cmostly conserved

271Cmostly conserved

278Cmostly conserved

322Cmostly conserved

340Tmostly conserved

364Amostly conserved

379Amostly conserved

448Tmostly conserved

541Amostly conserved

574Amostly conserved

616Cmostly conserved

634Cvariable

AACTTTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCTTTAAGAATACTAATTCGAGCTGAGTTAGGAAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes3

BINs2

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara pallipessame genus4.9%Amara angustatoidessame genus5.2%Amara plebejasame genus5.5%Amara kultisame genus5.6%Amara tricuspidatasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type263 records

Wild obs. + sensor1

Museum / vouchered262

Range

Area of Occupancy AOO348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 70≤10 km 12>10 km 2

84 georeferenced · 178 without coordinates

Open the institutions mapphysical evidence262

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	73
University of Alberta Museums (UAM)location not on record	58
San Francisco, US	57
Royal Saskatchewan Museumlocation not on record	39
San Diego, US	9
NEON Biorepository at Arizona State Universitylocation not on record	8
OSUClocation not on record	5
University of Alabamalocation not on record	4
WIlocation not on record	3
Essig Museum of Entomologylocation not on record	3
Saint John, CA	2
Colorado State Universitylocation not on record	1

12 institutions · 262 of 262 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Amara scitula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

grasslandHerbaceousevergreenForestshrubScruburban4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 8.70–18.8

Seasonal swing summer↔winter19.1 °C

Max temp (day)21.2 °C 14.9–25.9

Min temp (night)7.40 °C 1.80–11.3

Precipitation46.0 mm/mo 19.7–89.6

Air humidity52.7 % 47.0–58.0

Moisture balance-79.3 mm/mo -146–-9.00

Vapour deficit781 Pa 532–1,107

Wind speed2.30 m/s 1.10–2.60

Cloud cover34.8 % 23.8–39.5

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)