Amara obesa

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records2 726

Data sources6

Biological traits0

DNA specimens150

eDNA detections130

Sources6 archives

Databases and archives Amara obesa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 726 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI130 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics150 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 726 records

Environmental DNA1 datasets · 2 countries130 detections

DNA & barcodingBOLD150 specimens

01Narrative

Amara obesa is a species of seed-eating ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding150 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara obesa has left across the world's sequence archives.

At a glance

DNA specimens150

BINs2

Marker genes1

eDNA detections130

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus130 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

22Tmostly conserved

34Gmostly conserved

85Amostly conserved

115Tmostly conserved

229Amostly conserved

268Amostly conserved

280Amostly conserved

400Tmostly conserved

412Cmostly conserved

466Gmostly conserved

550Gmostly conserved

571Cmostly conserved

AACATTATATTTTATTTTTGGTGCATGATCAGGGATAGTAGGAACTTCTCTAAGTATACTAATTCGAGCTGAATTAGGTAACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes20

BINs2

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara fortissame genus4.7%Amara equestrissame genus7.1%Amara quenselisame genus8.8%Pterostichus inanissame family11.9%Poecilus lepidussame family12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 726 records

Wild obs. + sensor40

Museum / vouchered2 686

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 15≤1 km 8≤10 km 4>10 km 4

31 georeferenced · 9 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 735≤1 km 1 271≤10 km 113>10 km 209

2 328 georeferenced · 358 without coordinates

Open the institutions mapphysical evidence2 686

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	1 630
Tempe, US	552
WIlocation not on record	136
University of Alberta Museums (UAM)location not on record	87
Provo, US	60
Royal Saskatchewan Museumlocation not on record	55
Universidad Católica de Manizaleslocation not on record	29
Albuquerque, US	28
Espace pour la vielocation not on record	28
Colorado State Universitylocation not on record	13
Decorah, US	8
Essig Museum of Entomologylocation not on record	7
University of Alabamalocation not on record	7
NEON Biorepository at Arizona State Universitylocation not on record	7
EWIClocation not on record	3
US	3
Chicago, US	3
University of Colorado, Museum of Natural Historylocation not on record	3
Champaign, US	2
University Park, US	2
Saint John, CA	2
Carnegie Museum of Natural Historylocation not on record	2
OSUClocation not on record	2
ASUlocation not on record	1
Cambridge, US	1
Denver, US	1
CUlocation not on record	1
College Station, US	1

28 institutions · 2 674 of 2 686 vouchered records shown · 12 without an institution code

09Environmental DNA130 detections

Where the DNA of Amara obesa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found130

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 130 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate GrasslandgrasslandHerbaceouscultivatedCrops1. Forest & Woodland | 1.4. Temperate ForestshrubScrub4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 9.80–21.3

Seasonal swing summer↔winter26.1 °C

Max temp (day)25.1 °C 16.2–28.8

Min temp (night)13.2 °C 4.80–16.2

Precipitation60.6 mm/mo 23.3–88.6

Air humidity55.0 % 49.0–57.8

Moisture balance-73.1 mm/mo -155–-25.9

Vapour deficit932 Pa 530–1,295

Wind speed4.10 m/s 2.20–5.20

Cloud cover32.8 % 29.0–40.5

CHELSA 1981–2010, ~9 km grid, at location & month of 129 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amara obesa

At a glance

Sources6 archives

At a glance

Record type2 726 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 726 records