Amara glacialis

(Mannerheim, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records438

Data sources7

Biological traits0

DNA specimens19

eDNA detections16

Sources7 archives

Databases and archives Amara glacialis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility438 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF438 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD19 specimens

01Narrative

Amara glacialis is a species of seed-eating ground beetle in the subfamily Carabinae. It is found in Siberia and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara glacialis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes2

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

22Gmostly conserved

32Gmostly conserved

296Amostly conserved

317Gmostly conserved

374Gmostly conserved

496Amostly conserved

526Tmostly conserved

550Gmostly conserved

589Tmostly conserved

AACATTATATTTTATCTTTGGGGCATGATCAGGAATAGTAGGAACCTCTTTAAGAATACTGATTCGAACAGAATTAGGAAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes5

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara fulvasame genus6.2%Amara avidasame genus6.5%Amara exaratasame genus7.4%Amara kultisame genus10.9%Amara convexiorsame genus10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type438 records

Wild obs. + sensor1

Museum / vouchered435

Other2

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 212≤10 km 16

228 georeferenced · 207 without coordinates

Open the institutions mapphysical evidence435

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	228
University of Alberta Museums (UAM)location not on record	162
Royal Saskatchewan Museumlocation not on record	28
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Saint John, CA	1
University of Alaska Museumlocation not on record	1

7 institutions · 422 of 435 vouchered records shown · 6 without an institution code

09Environmental DNA16 detections

Where the DNA of Amara glacialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

under wood&rocks, sandy lake shore5. Wetlands (inland) | 5.1. Permanent Rivers…Sandy beach ridge1. Forest & Woodland|1.1. Boreal Forestunder boards on ground4. Native Grassland | 4.1. Tundra

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 7.60–14.0

Seasonal swing summer↔winter36.1 °C

Max temp (day)15.3 °C 10.2–17.7

Min temp (night)6.80 °C 5.00–9.20

Precipitation68.3 mm/mo 53.6–87.5

Air humidity58.6 % 55.2–63.6

Moisture balance-43.9 mm/mo -77.5–-10.3

Vapour deficit525 Pa 393–717

Wind speed4.00 m/s 2.80–4.90

Cloud cover51.0 % 43.1–58.8

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)