Amara californica

Dejean, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records646

Data sources7

Biological traits0

DNA specimens17

eDNA detections19

Sources7 archives

Databases and archives Amara californica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility646 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF646 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD17 specimens

01Narrative

Amara californica is a species of black coloured beetle of the genus Amara in the family Carabidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara californica has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections19

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

622Gmostly conserved

AACTTTATATTTTATCTTTGGAGCATGATCAGGAATAGTAGGTACTTCATTAAGTATACTAATTCGAGCAGAATTGGGAAATCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara farctasame genus5.8%Amara laevipennissame genus5.9%Amara ellipsissame genus5.9%Amara patruelissame genus6.2%Amara interstitialissame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type646 records

Wild obs. + sensor4

Museum / vouchered642

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3≤10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 114≤1 km 6≤10 km 32>10 km 19

171 georeferenced · 471 without coordinates

Open the institutions mapphysical evidence642

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	389
Tempe, US	108
San Francisco, US	56
San Diego, US	28
OSUClocation not on record	23
Provo, US	14
Essig Museum of Entomologylocation not on record	6
Chicago, US	4
Centro de Estudios en Zoología, Centro Universitario de Ciencias Biológicas y Agropecuarias, Universidad de Guadalajaralocation not on record	4
Colorado State Universitylocation not on record	3
Universidad Católica de Manizaleslocation not on record	2
National Biodiversity Institute, Costa Ricalocation not on record	2
EWIClocation not on record	1
US	1
San Francisco State Universitylocation not on record	1

15 institutions · 642 of 642 vouchered records shown

09Environmental DNA19 detections

Where the DNA of Amara californica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

shrubScrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 10.9–24.6

Seasonal swing summer↔winter19.1 °C

Max temp (day)24.5 °C 16.9–31.9

Min temp (night)12.6 °C 3.10–16.1

Precipitation9.50 mm/mo 6.20–36.2

Air humidity37.6 % 34.4–59.8

Moisture balance-154 mm/mo -179–-50.3

Vapour deficit1,284 Pa 649–1,932

Wind speed2.70 m/s 1.20–4.70

Cloud cover23.6 % 20.2–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)