Amara aurata

Dejean, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records228

Data sources7

Biological traits0

DNA specimens54

eDNA detections45

Sources7 archives

Databases and archives Amara aurata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility228 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics54 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF228 records

Environmental DNA1 datasets · 2 countries45 detections

DNA & barcodingBOLD54 specimens

01Narrative

Amara aurata is a species of beetle of the genus Amara in the family Carabidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding54 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara aurata has left across the world's sequence archives.

At a glance

DNA specimens54

BINs3

Marker genes1

eDNA detections45

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 67 variable positions, in barcode order

4Amostly conserved

34Cmostly conserved

43Amostly conserved

55Amostly conserved

58Tmostly conserved

59Cmostly conserved

70Amostly conserved

85Amostly conserved

88Tmostly conserved

139Amostly conserved

197Tmostly conserved

220Tmostly conserved

223Tmostly conserved

232Tmostly conserved

235Cmostly conserved

238Amostly conserved

266Tmostly conserved

268Amostly conserved

286Cmostly conserved

289Cmostly conserved

295Amostly conserved

298Tmostly conserved

301Amostly conserved

307Tmostly conserved

319Amostly conserved

322Gmostly conserved

325Tmostly conserved

331Gmostly conserved

334Tmostly conserved

335Gmostly conserved

337Cmostly conserved

343Cmostly conserved

346Tmostly conserved

347Tmostly conserved

349Amostly conserved

364Cmostly conserved

373Gmostly conserved

379Amostly conserved

400Tmostly conserved

407Cmostly conserved

421Cmostly conserved

457Cmostly conserved

472Cmostly conserved

474Cmostly conserved

475Amostly conserved

478Tmostly conserved

484Amostly conserved

493Tmostly conserved

499Tmostly conserved

508Amostly conserved

523Cmostly conserved

526Cmostly conserved

544Amostly conserved

548Cmostly conserved

553Tmostly conserved

556Cmostly conserved

562Amostly conserved

565Gmostly conserved

578Cmostly conserved

580Tmostly conserved

607Cmostly conserved

613Tmostly conserved

616Cmostly conserved

622Tmostly conserved

625Amostly conserved

634Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAGCATGATCAGGCATAGTAGGAACTTCTTTAAGAATTCTAATTCGAGCAGAATTAGGAAATCCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes9

BINs3

Most divergent pair10.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara nitidasame genus9.6%Amara kultisame genus9.7%Amara turbatasame genus9.7%Cyclotrachelus furtivussame family9.9%Amara laevipennissame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type228 records

Wild obs. + sensor10

Museum / vouchered218

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9

9 georeferenced · 1 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 82≤1 km 12≤10 km 13>10 km 14

121 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	102
San Francisco, US	47
University of Alberta Museums (UAM)location not on record	21
San Diego, US	16
Essig Museum of Entomologylocation not on record	11
NEON Biorepository at Arizona State Universitylocation not on record	7
Chicago, US	4
Provo, US	3
University of Alabamalocation not on record	3
Champaign, US	2
Universidad Católica de Manizaleslocation not on record	1
Washington, US	1

12 institutions · 218 of 218 vouchered records shown

09Environmental DNA45 detections

Where the DNA of Amara aurata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map2 countries0

shrubScrubgrasslandHerbaceousevergreenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 11.8–18.8

Seasonal swing summer↔winter19.1 °C

Max temp (day)26.1 °C 17.7–26.1

Min temp (night)11.2 °C 6.10–11.2

Precipitation20.7 mm/mo 20.7–61.4

Air humidity49.3 % 49.3–53.5

Moisture balance-146 mm/mo -146–2.20

Vapour deficit1,107 Pa 629–1,107

Wind speed2.50 m/s 2.20–2.50

Cloud cover30.4 % 30.4–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)