Amara angustata

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records151

Data sources6

Biological traits0

DNA specimens15

eDNA detections4

Sources6 archives

Databases and archives Amara angustata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility151 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF151 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD15 specimens

01Narrative

Amara angustata is a species of beetle of the genus Amara in the family Carabidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara angustata has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

37Gmostly conserved

295Gmostly conserved

316Gmostly conserved

420Cmostly conserved

421Amostly conserved

622Amostly conserved

AACTTTATATTTTATTTTTGGGGCATGATCAGGTATGGTAGGAACTTCCCTAAGTATATTAATTCGAGCTGAATTAGGTAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.20%

Haplotypes3

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara angustatoidessame genus4.6%Amara pallipessame genus5.3%Amara plebejasame genus5.5%Amara convexiorsame genus6.1%Amara tenaxsame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type151 records

Wild obs. + sensor7

Museum / vouchered144

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 1

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 16≤10 km 46>10 km 3

65 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence144

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	25
OSUClocation not on record	21
Decorah, US	16
University of Alberta Museums (UAM)location not on record	10
WIlocation not on record	7
Royal Saskatchewan Museumlocation not on record	7
University Park, US	6
University of Alabamalocation not on record	6
Provo, US	4
UDlocation not on record	4
Cambridge, US	2
Chicago, US	2
NEON Biorepository at Arizona State Universitylocation not on record	2
College Station, US	2
New Haven, US	1
CUlocation not on record	1
Lubbock, US	1
Espace pour la vielocation not on record	1
Colorado State Universitylocation not on record	1
EWIClocation not on record	1

20 institutions · 120 of 144 vouchered records shown · 24 without an institution code

09Environmental DNA4 detections

Where the DNA of Amara angustata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

pastureHay

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 16.4–23.5

Seasonal swing summer↔winter21.7 °C

Max temp (day)27.7 °C 21.7–28.3

Min temp (night)17.4 °C 11.0–18.6

Precipitation106 mm/mo 95.4–112

Air humidity57.2 % 55.8–58.8

Moisture balance-40.1 mm/mo -46.3–-8.10

Vapour deficit1,156 Pa 835–1,189

Wind speed2.30 m/s 2.20–2.90

Cloud cover33.0 % 32.7–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)