Amanita verna — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records868

Data sources10

Biological traits0

DNA specimens8

eDNA detections6

Sources10 archives

Databases and archives Amanita verna's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility868 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS14 compounds

Occurrence & distributionGBIF868 records

Environmental DNA2 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Amanita verna, commonly known as the fool's mushroom, destroying angel, mushroom fool or the spring destroying angel amanita, is a deadly poisonous basidiomycete fungus, one of many in the genus Amanita. Occurring in Europe in spring, A. verna associates with various deciduous and coniferous trees. The caps, stipes and gills are all white in colour.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition14 compounds

Compounds documented for Amanita verna across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cyclic peptides $ RiPPs-Amatoxins and Phallotoxins9

RiPPs-Amatoxins and Phallotoxins5

Documented compounds14 total

Compound	Amount	Source
(1R,14S,18R,20R,23S,28R,31R,34S)-28-[(2S)-2,3-dihydroxy-2-methylpropyl]-18-hydroxy-34-[(1S)-1-hydroxyethyl]-23,31-dimethyl-12-thia-10,16,22,25,27,30,33,36-octazapentacyclo[12.11.11.03,11.04,9.016,20]hexatriaconta-3(11),4,6,8-tetraene-15,21,24,26,29,32,35-heptone	present	LOTUS
(1S,14R,18S,20S,23S,28S,31S,34R)-28-[2,3-dihydroxy-2-(hydroxymethyl)propyl]-18-hydroxy-34-[(1S)-1-hydroxyethyl]-23,31-dimethyl-12-thia-10,16,22,25,27,30,33,36-octazapentacyclo[12.11.11.03,11.04,9.016,20]hexatriaconta-3(11),4,6,8-tetraene-15,21,24,26,29,32,35-heptone	present	LOTUS
(2S)-2-[(1S,14R,18S,20S,23S,28S,31S,34R)-28-(2,3-dihydroxy-2-methylpropyl)-18-hydroxy-23-methyl-15,21,24,26,29,32,35-heptaoxo-31-propan-2-yl-12-thia-10,16,22,25,27,30,33,36-octazapentacyclo[12.11.11.03,11.04,9.016,20]hexatriaconta-3(11),4,6,8-tetraen-34-yl]-2-hydroxyacetic acid	present	LOTUS
2-[(1R,4S,8R,10S,13S,16S,27S,34S)-34-[(2S)-butan-2-yl]-13-[(2R,3R)-3,4-dihydroxybutan-2-yl]-8,22-dihydroxy-2,5,11,14,27,30,33,36,39-nonaoxo-27lambda4-thia-3,6,12,15,25,29,32,35,38-nonazapentacyclo[14.12.11.06,10.018,26.019,24]nonatriaconta-18(26),19(24),20,22-tetraen-4-yl]acetamide	present	LOTUS
2-[(1R,4S,8R,10S,13S,16S,27S,34S)-34-[(2S)-butan-2-yl]-13-[(2R,3R)-3,4-dihydroxybutan-2-yl]-8,22-dihydroxy-2,5,11,14,27,30,33,36,39-nonaoxo-27lambda4-thia-3,6,12,15,25,29,32,35,38-nonazapentacyclo[14.12.11.06,10.018,26.019,24]nonatriaconta-18(26),19(24),20,22-tetraen-4-yl]acetic acid	present	LOTUS
2-[(1S,4S,10S,13S,16S,34S)-34-[(2R)-butan-2-yl]-13-[(2R,3R)-3,4-dihydroxybutan-2-yl]-8,22-dihydroxy-2,5,11,14,27,30,33,36,39-nonaoxo-27lambda4-thia-3,6,12,15,25,29,32,35,38-nonazapentacyclo[14.12.11.06,10.018,26.019,24]nonatriaconta-18(26),19(24),20,22-tetraen-4-yl]acetic acid	present	LOTUS
2-[34-Butan-2-yl-8,22-dihydroxy-13-(3-hydroxybutan-2-yl)-2,5,11,14,30,33,36,39-octaoxo-27-thia-3,6,12,15,25,29,32,35,38-nonazapentacyclo[14.12.11.06,10.018,26.019,24]nonatriaconta-18(26),19(24),20,22-tetraen-4-yl]acetamide	present	LOTUS
C39H54N10O14S	present	LOTUS
cyclic(L-Alanyl-2-mercapto-L-tryptophyl-4,5-dihydroxy-L-leucyl-L-valyl-erythro-3-hydroxy-D-alpha-aspartyl-L-cysteinyl-cis-4-hydroxy-L-prolyl) cyclic (2-6)-sulfide	present	LOTUS
gamma-Amanitin	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita verna has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections6

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMK895675.1 ↗218 bpUSA · 1969

ACGT

TTAATGAGATGAACCTTGAGGCTGTAGCTGGCCCATCTGGGCATGTGCACGTCTCTGGTCATTACCAATTCCACCTGTGCACACTTGTAG …

Amanita verna internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10ITS1

fungal barcode

08Occurrence & distribution

Record type868 records

Wild obs. + sensor249

Museum / vouchered603

Other16

Origin

Native2

Range

Area of Occupancy AOO2 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 17≤1 km 18≤10 km 151>10 km 8

194 georeferenced · 55 without coordinates

Open the mapobservation + sensor249

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 42≤1 km 72≤10 km 181>10 km 22

317 georeferenced · 286 without coordinates

Open the institutions mapphysical evidence603

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions33 of 56 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	146
Catholic University of Pekinglocation not on record	57
Chapel Hill, US	52
Bernard Price Institute for Palaeontological Researchlocation not on record	47
Chicago, US	42
Zapopan, MX	28
WTUlocation not on record	22
Durango, MX	21
FLASlocation not on record	17
St. Paul, US	17
Toronto, CA	16
Tomioka, JP	13
BDBClocation not on record	10
Bando, JP	9
ILLSlocation not on record	6
Ann Arbor, US	6
Champaign, US	5
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	5
Uniwersytet Łódzkilocation not on record	5
TENN-Flocation not on record	5
Kyiv, UA	4
Olocation not on record	4
San Sebastián, ES	4
Laramie, US	3
MeiseBGlocation not on record	3
Osaka, JP	3
Acadia Universitylocation not on record	2
Tartu, EE	2
TROMlocation not on record	2
Nagatoro-machi, Chichibu-gun, JP	2
Blacksburg, US	2
TUR-Alocation not on record	2
Mexico City, MX	2
Uppsala, SE	2
Bardejov, SK	2
GJOlocation not on record	1
Madison, US	1
Centro de Estudios Superiores del Estado de Sonoralocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Ciudad de México, MX	1
Logan, US	1
Baton Rouge, US	1
Odawara, JP	1
Université de Montréal Biodiversity Centrelocation not on record	1
PHlocation not on record	1
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	1
Pullman, US	1
Royal Ontario Museum, TRTC Fungariumlocation not on record	1
Orto botanico di Lucca \| Botanical Garden of Luccalocation not on record	1
Kensington, AU	1
Karlsruhe, DE	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Vitoria, ES	1
Denver, US	1
Zürich, CH	1
Paris, FR	1

56 institutions · 589 of 603 vouchered records shown · 14 without an institution code

09Environmental DNA6 detections

Where the DNA of Amanita verna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 12.7–12.7

Seasonal swing summer↔winter29.3 °C

Max temp (day)17.7 °C

Min temp (night)10.2 °C

Precipitation112 mm/mo

Air humidity62.7 %

Moisture balance35.3 mm/mo

Vapour deficit547 Pa

Wind speed3.00 m/s

Cloud cover50.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.