Amanita regalis

(Fr.) Michael · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records7 699

Data sources9

Biological traits0

DNA specimens13

eDNA detections817

Sources9 archives

Databases and archives Amanita regalis's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 699 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI817 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 699 records

Environmental DNA5 datasets · 12 countries817 detections

DNA & barcodingBOLD · NCBI13 specimens

01Narrative

Amanita regalis, commonly known as the royal fly agaric or the king of Sweden Amanita, is a species of fungus in the family Amanitaceae. Common in Scandinavian countries, it is also found in eastern and northern Europe. In North America, its distribution is restricted to Alaska. The fruit bodies of the fungus somewhat resemble the fly agaric (Amanita muscaria), and it was formerly regarded as a variety of this species. A. regalis differs from it in being larger, with a liver-brown cap bearing numerous scabs, and in having a stem which is yellow-ochre at the base, with patches or rings of patches. Chemical analysis has shown that this species contains muscimol, the same psychoactive compound found in A. muscaria.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita regalis has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes2

GenBank sequences10

eDNA detections817

Countries12

The DNA barcodea real sequence read deposited for this species

ITSMH508537.1 ↗585 bpCzech Republic

ACGT

GGTGGTTGTAGCTGGCCCCTAGGGGCATGTGCACACTGTGTCTCTCTTGCTTGTTTCTTCATTCTCTCCACTTGTGCACTACTTGTAGGC …

Amanita regalis voucher HKAS56699 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type7 699 records

Wild obs. + sensor7 386

Museum / vouchered307

Cultivated / captive6

Origin

Introduced4

Range

Area of Occupancy AOO17 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 3 352≤1 km 2 911≤10 km 537>10 km 53

6 853 georeferenced · 533 without coordinates

Open the mapobservation + sensor7 386

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 20≤1 km 106≤10 km 50>10 km 30

206 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence307

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 2 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	62
Helsinki, FI	27
Uppsala, SE	22
Joensuu, FI	17
Trondheim, NO	17
WU-MYClocation not on record	16
TUR-Alocation not on record	12
Philadelphia, US	11
Tartu, EE	7
SLU Artdatabankenlocation not on record	6
Kuopio, FI	6
Göteborg, SE	5
Görlitz, DE	5
TROMlocation not on record	5
LDlocation not on record	4
University of Oslo, Natural History Museumlocation not on record	3
Copenhagen, DK	3
Chicago, US	3
Durham, US	3
Berlin, DE	2
Adam Mickiewicz University in Poznańlocation not on record	2
Oulu, FI	2
Jyväskylä, FI	1
Surgut State Universitylocation not on record	1
Ciudad de México, MX	1
TENN-Flocation not on record	1
Turku, FI	1
GJOlocation not on record	1
Tromso University Museumlocation not on record	1
Provincia di Livornolocation not on record	1
IB FRC Komi SC UB RASlocation not on record	1
Bronx, US	1

32 institutions · 250 of 307 vouchered records shown · 55 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA817 detections

Where the DNA of Amanita regalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found817

Studies independent surveys5

Countries12

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 817 detections have coordinates

Open the map12 countries0

Southern/middle boreal low herb Picea forest…Sandig veikant i skogsbilveg, med gran, furu…Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 6.20–17.8

Seasonal swing summer↔winter21.4 °C

Max temp (day)18.7 °C 9.50–21.4

Min temp (night)11.6 °C 3.80–14.2

Precipitation79.3 mm/mo 56.6–92.7

Air humidity60.3 % 58.2–64.9

Moisture balance-17.3 mm/mo -50.4–47.8

Vapour deficit687 Pa 339–810

Wind speed3.20 m/s 2.40–5.30

Cloud cover40.5 % 33.9–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 810 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amanita regalis

At a glance

Sources9 archives

At a glance

Record type7 699 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 32 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 699 records