Amanita protecta

Tulloss & G.Wright · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records141

Data sources6

Biological traits0

DNA specimens8

eDNA detections9

Sources6 archives

Databases and archives Amanita protecta's data was compiled from.

GBIFGlobal Biodiversity Information Facility141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF141 records

Environmental DNA2 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI8 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita protecta has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ271473.1 ↗256 bpUSA · 1969

ACGT

GAACGCATCTTGCGCTCCTTGGCATTCCAAGGAGCATGCCTGTTTGAGTGTCGTTAAACTATCAAAACACTTTTCTTGGGTGTTTTGGAC …

Amanita protecta isolate MICH CIB voucher MICH:191972 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type141 records

Wild obs. + sensor126

Museum / vouchered15

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 39≤1 km 20≤10 km 26>10 km 22

107 georeferenced · 19 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
California State University, East Baylocation not on record	3
Chicago, US	1
Santa Cruz, US	1
Personal Herbarium of Joanne Schwartzlocation not on record	1

4 institutions · 6 of 15 vouchered records shown · 9 without an institution code

09Environmental DNA9 detections

Where the DNA of Amanita protecta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

ForestIn Leaf Litter; Oak

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 11.5–13.1

Seasonal swing summer↔winter4.90 °C

Max temp (day)15.3 °C 14.9–15.4

Min temp (night)9.80 °C 8.30–11.7

Precipitation101 mm/mo 96.6–117

Air humidity59.2 % 57.0–59.8

Vapour deficit578 Pa 547–649

Cloud cover42.6 % 42.3–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)