Amanita ponderosa

Malençon & R.Heim · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records91

Data sources7

Biological traits0

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Amanita ponderosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility91 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF91 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Amanita ponderosa est une espèce de champignons de la famille des Amanitaceae, présente uniquement dans le sud-ouest de la Péninsule ibérique et dans certaines régions d'Italie et d'Afrique du Nord. Amanita ponderosa, dont le nom vulgaire en espagnol est gurumelo, est un champignon comestible très apprécié en Espagne.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita ponderosa has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences9

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ950794.1 ↗634 bp

ACGT

CTCTGGCAAGAGGCTGTTGCTGGCCCTAGGGCATGTGCACGTCTCTGTTATTGCCAGTTTTTGTTCACATTTTCCTGTGCATTTTTGTAG …

Amanita ponderosa isolate P02 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1

fungal barcode

08Occurrence & distribution

Record type91 records

Wild obs. + sensor64

Museum / vouchered27

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 4≤1 km 8≤10 km 5>10 km 4

21 georeferenced · 43 without coordinates

Open the mapobservation + sensor64

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 5

13 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zapopan, MX	7
JA-CAGPDS-CAMlocation not on record	6
Córdoba, ES	5
San Sebastián, ES	2
Mérida, ES	2
Mexico City, MX	1
BDBClocation not on record	1
MAlocation not on record	1
Gijón, ES	1
Durango, MX	1

10 institutions · 27 of 27 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Amanita ponderosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)