Amanita persicina

(D.T.Jenkins) Tulloss & Geml · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records3 972

Data sources7

Biological traits0

DNA specimens5

eDNA detections107

Sources7 archives

Databases and archives Amanita persicina's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 972 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI107 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 972 records

Environmental DNA4 datasets · 1 countries107 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Amanita persicina, commonly known as the peach-colored fly agaric, is a basidiomycete fungus of the genus Amanita. This fungus was previously believed to be a variety of Amanita muscaria, but research has recently shown that Amanita persicina is best treated as a distinct species. Amanita persicina is distinguished by its peach-colored center and its eastern North American distribution.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita persicina has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences10

eDNA detections107

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV330494.1 ↗545 bpUSA · 2024

ACGT

GGTGTAGCTGGCCTCTAGGGGCATGTGCACACTGTCTCTCTCTTGCTTGTTTCTTCATTCTCTCCACTTGTGCACTGCTTGTAGGCAGTC …

Amanita persicina isolate FMS iNaturalist # 256851849 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type3 972 records

Wild obs. + sensor3 954

Museum / vouchered18

Range

Area of Occupancy AOO9 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 2 143≤1 km 475≤10 km 310>10 km 447

3 375 georeferenced · 579 without coordinates

Open the mapobservation + sensor3 954

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 3≤1 km 2>10 km 1

6 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	3
Durham, US	3
ILLSlocation not on record	3
Chicago, US	2
Private Collection of Alisha Millicanlocation not on record	1
Colorado State Universitylocation not on record	1

6 institutions · 13 of 18 vouchered records shown · 4 without an institution code

09Environmental DNA107 detections

Where the DNA of Amanita persicina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found107

Studies independent surveys4

Countries1

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 107 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.8 °C 17.9–27.8

Seasonal swing summer↔winter17.0 °C

Max temp (day)33.0 °C 23.7–33.0

Min temp (night)23.7 °C 13.9–23.7

Precipitation135 mm/mo 97.2–135

Air humidity61.6 % 58.7–61.6

Moisture balance-38.7 mm/mo -38.7–8.00

Vapour deficit1,426 Pa 847–1,426

Wind speed1.70 m/s 1.70–2.40

Cloud cover24.0 % 24.0–35.8

CHELSA 1981–2010, ~9 km grid, at location & month of 103 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amanita persicina

At a glance

Sources7 archives

At a glance

Record type3 972 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 972 records