Amanita olivaceogrisea

Kalamees · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records361

Data sources8

Biological traits0

DNA specimens3

eDNA detections6

Sources8 archives

Databases and archives Amanita olivaceogrisea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility361 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF361 records

Environmental DNA2 datasets · 4 countries6 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Muchomor oliwkowoszary – gatunek grzybów należący do rodziny muchomorowatych (Amanitaceae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita olivaceogrisea has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences10

eDNA detections6

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPV121562.1 ↗515 bpFrance · 2023

ACGT

ACTATTATCGAATGAAACTTCTGGCCGGATGCTGTTGTGCTGGCCCTTTGGGGCAATGTGCACACCTCTGGTCGTCTGTTTCTTCTGTTC …

Amanita olivaceogrisea isolate XC23-207 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type361 records

Wild obs. + sensor213

Museum / vouchered148

Range

Area of Occupancy AOO940 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 111≤1 km 12≤10 km 82>10 km 1

206 georeferenced · 7 without coordinates

Open the mapobservation + sensor213

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 28≤1 km 34≤10 km 5>10 km 3

70 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	37
Philadelphia, US	35
Copenhagen, DK	12
Kew, GB	9
Tartu, EE	8
Turku, FI	4
TUR-Alocation not on record	4
Olocation not on record	3
Joensuu, FI	3
Oulu, FI	3
nsnflocation not on record	3
University of Oslo, Natural History Museumlocation not on record	1
NAlocation not on record	1
Salzburg, AT	1
WU-MYClocation not on record	1
MeiseBGlocation not on record	1
Göteborg, SE	1
SLU Artdatabankenlocation not on record	1

18 institutions · 128 of 148 vouchered records shown · 20 without an institution code

09Environmental DNA6 detections

Where the DNA of Amanita olivaceogrisea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map4 countries0

PalearcticRich deciduous forest on marine deposits, do…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 3.80–11.7

Seasonal swing summer↔winter18.1 °C

Max temp (day)13.4 °C 6.20–14.8

Min temp (night)5.80 °C 0–8.30

Precipitation75.8 mm/mo 63.6–165

Air humidity62.6 % 58.5–66.8

Moisture balance18.1 mm/mo -24.9–111

Vapour deficit513 Pa 302–597

Wind speed3.50 m/s 2.60–5.70

Cloud cover43.6 % 33.7–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)