Amanita novinupta

Tulloss & J.Lindgr. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records1 450

Data sources8

Biological traits0

DNA specimens20

eDNA detections23

Sources8 archives

Databases and archives Amanita novinupta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 450 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 450 records

Environmental DNA3 datasets · 3 countries23 detections

DNA & barcodingBOLD · NCBI20 specimens

01Narrative

Amanita novinupta (лат.) — гриб семейства мухоморовые (Amanitaceae). Включён в подрод Lepidella рода Amanita. Ранее не выделялся из вида Amanita rubescens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita novinupta has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes2

GenBank sequences10

eDNA detections23

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPZ271431.1 ↗294 bpUSA · 1939

ACGT

GAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATATCTCAAAAAGCTTGTGCTTTTTTGGCATGG …

Amanita novinupta isolate MICH CIB P. M. Rea 158 voucher MICH:190268 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 450 records

Wild obs. + sensor1 385

Museum / vouchered65

Range

Area of Occupancy AOO2 836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 734≤1 km 179≤10 km 141>10 km 125

1 179 georeferenced · 206 without coordinates

Open the mapobservation + sensor1 385

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 5≤1 km 4≤10 km 4>10 km 1

14 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	10
Mexico City, MX	10
WTUlocation not on record	5
Santa Cruz, US	4
Vancouver, CA	3
Olocation not on record	3
California State University, East Baylocation not on record	2
nsnflocation not on record	2
Chicago, US	1
Personal Herbarium of Joanne Schwartzlocation not on record	1

10 institutions · 41 of 65 vouchered records shown · 20 without an institution code

09Environmental DNA23 detections

Where the DNA of Amanita novinupta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys3

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map3 countries0

NeotropicNearcticForestOn Soil with Oak duff; Oak woodland; Coast L…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 12.2–18.8

Seasonal swing summer↔winter5.90 °C

Max temp (day)18.1 °C 15.2–23.3

Min temp (night)8.20 °C 7.70–13.8

Precipitation139 mm/mo 70.8–314

Air humidity62.6 % 57.3–68.0

Moisture balance78.3 mm/mo -46.3–181

Vapour deficit599 Pa 523–829

Wind speed2.20 m/s 0.7–5.80

Cloud cover30.0 % 26.3–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amanita novinupta

At a glance

Sources8 archives

At a glance

Record type1 450 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 450 records