Amanita nehuta — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records363

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Amanita nehuta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility363 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF363 records

DNA & barcodingNCBIsequences

01Narrative

Amanita nehuta, also called Maori dust amanita, is a species of fungus in the family Amanitaceae. It was first described by New Zealand mycologist Geoff Ridley in 1991. It occurs in New Zealand in large number. It has only a dark ring rather than a universal veil and white spores. It is found under leptospermum and Nothofagus. It grows on ground usually in late summer. Its height is 110 mm and width is 100 mm.Family: Pluteaceae (Amanita) and species http://www.hiddenforest.co.nz/fungi/family/pluteaceae/amanitAmanitahtm

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita nehuta has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ064954.1 ↗718 bpNew Zealand

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAAAGAAAACCTCAGGCAAAAGAGGGGAGGGGGAAAATTTG …

Amanita nehuta voucher OTA:71565 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type363 records

Wild obs. + sensor295

Museum / vouchered68

Range

Area of Occupancy AOO912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 128≤1 km 63≤10 km 20>10 km 15

226 georeferenced · 69 without coordinates

Open the mapobservation + sensor295

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	63
Leicester, GB	4

2 institutions · 67 of 68 vouchered records shown · 1 without an institution code