Amanita merxmuelleri — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records61

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Amanita merxmuelleri's data was compiled from.

GBIFGlobal Biodiversity Information Facility61 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF61 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita merxmuelleri has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY462291.1 ↗560 bpArgentina

ACGT

CATTATCGAAGCGATGGAAAGGTTGTCGCTGGCCTCTAGGGGCATTGTGCACGCCTTTCTTGTTCTTCTTCCATCCCACCTGTGCACCGG …

Amanita merxmuelleri voucher CT-4216 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor59

Museum / vouchered2

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 19≤1 km 19≤10 km 2>10 km 5

45 georeferenced · 14 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
FLASlocation not on record	2

1 institutions · 2 of 2 vouchered records shown