Amanita magniverrucata

Thiers & Ammirati · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records606

Data sources11

Biological traits0

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Amanita magniverrucata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility606 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF606 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Amanita magniverrucata, commonly known as great pine jewel, is a species of agaric mushroom in the family Amanitaceae. First described scientifically by American mycologists Harry Delbert Thiers and Joseph Ammirati in 1982, it is mycorrhizal and associates with the tree Pinus radiata. While its edibility is unknown, it may be poisonous, as are many Amanitas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition4 compounds

Compounds documented for Amanita magniverrucata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Arsenic Acid	present	LOTUS
Arsenous acid	present	LOTUS
Dimethylarsinic Acid	present	LOTUS
Methylarsonic acid	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita magniverrucata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ271427.1 ↗300 bpUSA · 1950

ACGT

GAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATATCTCAAAAGCTCCCTTATGCCTCTCTTGTG …

Amanita magniverrucata isolate MICH CIB M. G. Rea F. 11 voucher MICH:189437 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type606 records

Wild obs. + sensor591

Museum / vouchered15

Range

Area of Occupancy AOO1 396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 296≤1 km 85≤10 km 63>10 km 61

505 georeferenced · 86 without coordinates

Open the mapobservation + sensor591

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
Denver, US	1
California State University, East Baylocation not on record	1
Santa Cruz, US	1
ILLSlocation not on record	1

6 institutions · 8 of 15 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Amanita magniverrucata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Shrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 11.7–11.7

Seasonal swing summer↔winter4.80 °C

Max temp (day)14.0 °C

Min temp (night)9.50 °C

Precipitation114 mm/mo

Air humidity67.0 %

Moisture balance20.3 mm/mo

Vapour deficit451 Pa

Wind speed4.20 m/s

Cloud cover48.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)