Amanita magnivelaris

Peck · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records181

Data sources9

Biological traits0

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Amanita magnivelaris's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility181 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF181 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Amanita magnivelaris, commonly known as the great felt skirt destroying angel or the great feltskirt destroying angel amanita, is a highly toxic basidiomycete fungus, one of many in the genus Amanita. Originally described from Ithaca, New York, by Charles Horton Peck, it is found in New York state and southeastern Canada.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita magnivelaris has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX369690.1 ↗689 bpUSA · 2024

ACGT

GAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAGTGAAATTGGCTTAGAGACTGTTGCTGGCTCTTTTGG …

Amanita magnivelaris isolate OMDL iNat # 238334445 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type181 records

Wild obs. + sensor85

Museum / vouchered96

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 19≤1 km 10≤10 km 10>10 km 6

45 georeferenced · 40 without coordinates

Open the mapobservation + sensor85

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 47≤1 km 13≤10 km 18>10 km 7

85 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zapopan, MX	39
Chapel Hill, US	11
Catholic University of Pekinglocation not on record	9
Durango, MX	7
Chicago, US	6
Bernard Price Institute for Palaeontological Researchlocation not on record	5
Université de Montréal Biodiversity Centrelocation not on record	5
Mexico City, MX	2
Ann Arbor, US	2
Ciudad de México, MX	2
Blacksburg, US	2
Bronx, US	1
Mexico City, MX	1
Davis and Elkins Collegelocation not on record	1
FLASlocation not on record	1
St. Paul, US	1
Baton Rouge, US	1

17 institutions · 96 of 96 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Amanita magnivelaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)