Amanita longipes

Bas ex Tulloss & D.T.Jenkins · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records88

Data sources8

Biological traits0

DNA specimens1

eDNA detections3

Sources8 archives

Databases and archives Amanita longipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF88 records

Environmental DNA2 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Amanita longipes is a small inedible mushroom species of the Amanita genus. It feeds on decaying leaves of some woods and can be found around the Appalachian Mountains. It is a food source for various insects.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita longipes has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK580752.1 ↗544 bpUSA · 2000

ACGT

CTGCGGAAGGATCATTATTGAATGAAAATGGCTTGAGGCTGTAGCTGGCTCTTGGGAGCATGTGCACGTCTCTTGCCTATTTGCTTCATC …

Amanita longipes isolate 1770 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor66

Museum / vouchered22

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 14≤1 km 3≤10 km 9>10 km 7

33 georeferenced · 33 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 3≤10 km 5

8 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	6
Chicago, US	3
FLASlocation not on record	3
ILLSlocation not on record	3
Davis and Elkins Collegelocation not on record	1
TENN-Flocation not on record	1
Durham, US	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Asheville, US	1

9 institutions · 20 of 22 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Amanita longipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Indomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.7–25.7

Seasonal swing summer↔winter6.60 °C

Max temp (day)30.2 °C

Min temp (night)21.1 °C

Precipitation181 mm/mo

Air humidity61.4 %

Moisture balance39.2 mm/mo

Vapour deficit1,272 Pa

Wind speed2.60 m/s

Cloud cover59.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)