Amanita frostiana

(Peck) Sacc. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records1 353

Data sources9

Biological traits0

DNA specimens3

eDNA detections149

Sources9 archives

Databases and archives Amanita frostiana's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 353 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI149 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 353 records

Environmental DNA3 datasets · 4 countries149 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Amanita frostiana, also known as Frost's amanita, is a small fungus species of eastern U.S. and southeastern Canada. The mushroom varies in colours from yellow, red or reddish pink usually.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita frostiana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections149

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMH211685.1 ↗417 bpUSA · 2017

ACGT

AATAATTGTTGTACAGAATGTTTTTAAAAAAGTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAA …

Amanita frostiana voucher FLAS-F-60921 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 353 records

Wild obs. + sensor1 121

Museum / vouchered232

Range

Area of Occupancy AOO3 972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 571≤1 km 158≤10 km 142>10 km 90

961 georeferenced · 160 without coordinates

Open the mapobservation + sensor1 121

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 3≤1 km 26≤10 km 79>10 km 12

120 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence232

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	83
Catholic University of Pekinglocation not on record	29
Bernard Price Institute for Palaeontological Researchlocation not on record	24
Chapel Hill, US	22
Toronto, CA	12
Ann Arbor, US	11
TENN-Flocation not on record	7
Davis and Elkins Collegelocation not on record	7
WTUlocation not on record	6
Chicago, US	4
Université de Montréal Biodiversity Centrelocation not on record	4
St. Paul, US	4
Acadia Universitylocation not on record	2
McWane Science Centerlocation not on record	2
Laramie, US	2
FLASlocation not on record	2
Mexico City, MX	1
Lincoln, US	1
CA	1
Kew, GB	1
Blacksburg, US	1

21 institutions · 226 of 232 vouchered records shown · 4 without an institution code

09Environmental DNA149 detections

Where the DNA of Amanita frostiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found149

Studies independent surveys3

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 149 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.2 °C 14.3–18.1

pH5.40 4.20–7.40

Conductivity49.5 µS/cm 11.0–374

Organic carbon3.19 % 0.06–5.55

Water content21.4 % 2.99–79.2

Nitrate-N3.00 mg/kg 1.00–11.0

Phosphorus28.0 mg/kg 4.00–95.0

Clay16.1 % 0.93–52.0

Sand66.2 % 33.7–98.1

Depth0 m 0–0.2

SoilTenosolsChromosolsSodosolLatLon out of rangeTenosol

29 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 6.30–23.1

Seasonal swing summer↔winter6.10 °C

Max temp (day)26.1 °C 9.30–26.5

Min temp (night)16.8 °C 2.90–19.2

Precipitation63.7 mm/mo 59.3–91.6

Air humidity62.3 % 58.9–64.2

Moisture balance-76.4 mm/mo -92.9–34.9

Vapour deficit922 Pa 319–1,116

Wind speed2.80 m/s 2.60–3.20

Cloud cover29.6 % 17.4–35.5

CHELSA 1981–2010, ~9 km grid, at location & month of 149 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amanita frostiana

At a glance

Sources9 archives

At a glance

Record type1 353 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 353 records