Amanita friabilis

(P.Karst.) Bas · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records304

Data sources7

Biological traits0

DNA specimens4

eDNA detections17

Sources7 archives

Databases and archives Amanita friabilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility304 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF304 records

Environmental DNA3 datasets · 3 countries17 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Amanita friabilis, l'Amanite des aulnes, est une espèce de champignons agaricomycètes (Fungi) de la famille des Amanitaceae et du genre Amanita. Il s'agit de l'une des plus petites espèces du genre Amanita. Sa volve très friable laisse de nombreuses petites plaques grises sur son chapeau et son pied, ce qui lui donne un aspect poudreux-farinacé. L'espèce affectionne les sols forestiers humides et le long des cours d'eau où elle vit en association obligatoire avec les aulnes. Sa présence est un critère qualifiant la naturalité du lieu. Elle a longtemps été considérée comme endémique d'Europe où elle est rare à très rare, mais elle est également présente dans le Caucase et en Amérique du Nord.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita friabilis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences10

eDNA detections17

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPP375800.1 ↗507 bpHungary · 2013

ACGT

CATTATTGAATGAAACCTCTGGCTAGATGCCTGTTGTGCTGGCCCTTTGGGGGCAATGTGCACACCTCTGGTCATTTGTTTCTTCTGTTC …

Amanita friabilis voucher AL 13/109 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type304 records

Wild obs. + sensor185

Museum / vouchered108

Other11

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 63≤1 km 29≤10 km 74>10 km 5

171 georeferenced · 14 without coordinates

Open the mapobservation + sensor185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 16≤1 km 42≤10 km 10>10 km 15

83 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	32
Uppsala, SE	13
SLU Artdatabankenlocation not on record	10
Olocation not on record	8
WU-MYClocation not on record	5
Joensuu, FI	4
Kew, GB	3
Trondheim, NO	2
Turku, FI	2
Copenhagen, DK	2
Görlitz, DE	2
TUR-Alocation not on record	2
University of Oslo, Natural History Museumlocation not on record	2
Göteborg, SE	2
Jyväskylä, FI	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
MAlocation not on record	1
Karlsruhe, DE	1
Gijón, ES	1
Zürich, CH	1
Salzburg, AT	1
nsnflocation not on record	1
Kuopio, FI	1
Tartu, EE	1

24 institutions · 100 of 108 vouchered records shown · 8 without an institution code

09Environmental DNA17 detections

Where the DNA of Amanita friabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map3 countries0

GrÃ¥orskog, fuktig

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 10.6–17.8

Seasonal swing summer↔winter21.4 °C

Max temp (day)18.0 °C 13.7–20.0

Min temp (night)15.4 °C 6.20–16.4

Precipitation65.6 mm/mo 55.9–106

Air humidity60.3 % 57.2–62.7

Vapour deficit740 Pa 509–809

Cloud cover36.8 % 34.6–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)