Amanita flavipes

S.Imai · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records88

Data sources7

Biological traits0

DNA specimens4

eDNA detections14

Sources7 archives

Databases and archives Amanita flavipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF88 records

Environmental DNA3 datasets · 7 countries14 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Мухомо́р желтоно́жковый — вид грибов, входящий в род Мухомор (Amanita) семейства Мухоморовые (Amanitaceae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita flavipes has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

eDNA detections14

Countries7

The DNA barcodea real sequence read deposited for this species

ITSPP265120.1 ↗290 bpChina · 2020

ACGT

AAGGATCATTACTGAGCGAAATGGGTGGCAAGGCTGTCGCTGGCTCAAACGAGCATGTGCACGTCTTTTGCTGCTTGCTTCATTCTCTTT …

Amanita flavipes voucher CAIQ12025 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor28

Museum / vouchered60

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 8≤1 km 3≤10 km 3>10 km 9

23 georeferenced · 5 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 1≤1 km 8≤10 km 1

10 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Osaka, JP	9
Tomioka, JP	8
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	6
KOMlocation not on record	5
Durango, MX	5
Universidade de Lisboa, Museu Bocagelocation not on record	4
Mexico City, MX	3
Bando, JP	3
Nagatoro-machi, Chichibu-gun, JP	2
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	2
Durham, US	2
Bernard Price Institute for Palaeontological Researchlocation not on record	1
FLASlocation not on record	1

13 institutions · 51 of 60 vouchered records shown · 9 without an institution code

09Environmental DNA14 detections

Where the DNA of Amanita flavipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys3

Countries7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map7 countries0

AustralasiaNeotropicPalearcticIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 6.60–25.7

Seasonal swing summer↔winter5.90 °C

Max temp (day)21.1 °C 10.3–29.5

Min temp (night)13.0 °C 1.00–22.2

Precipitation190 mm/mo 87.1–260

Air humidity67.4 % 63.4–69.3

Moisture balance53.3 mm/mo -34.9–134

Vapour deficit642 Pa 368–1,098

Wind speed1.90 m/s 0.7–2.20

Cloud cover34.5 % 29.6–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)