Amanita eliae

Quél. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records621

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Amanita eliae's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility621 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF621 records

DNA & barcodingNCBIsequences

01Narrative

Amanita eliae is an inedible species of fungi in the family of Amanitaceae found in Europe. It was described by Lucien Quélet in 1872. Synonyms include Amanitaria eliae, Amanita godeyi, and Amanita cordae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita eliae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJF907763.1 ↗217 bpItaly · 2008

ACGT

TTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGGGGAAACCTATGGCTAGTTGCTGTTTTGCTGGCATTCATGCAATGTGCACGC …

Amanita eliae voucher 16808 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type621 records

Wild obs. + sensor520

Museum / vouchered97

Other4

Origin

Native2

Range

Area of Occupancy AOO1 632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 28≤1 km 43≤10 km 383>10 km 13

467 georeferenced · 53 without coordinates

Open the mapobservation + sensor520

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 3≤1 km 25≤10 km 19>10 km 1

48 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Sebastián, ES	19
Vitoria, ES	7
Kew, GB	6
GJOlocation not on record	5
Karlsruhe, DE	4
Córdoba, ES	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	3
SLU Artdatabankenlocation not on record	3
Copenhagen, DK	2
Görlitz, DE	2
LDlocation not on record	2
Catholic University of Pekinglocation not on record	2
WU-MYClocation not on record	2
TENN-Flocation not on record	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
JA-CAGPDS-CAMlocation not on record	2
MAlocation not on record	1
BDBClocation not on record	1
Berlin, DE	1
University of the Basque Country (UPV/EHU)location not on record	1
Chapel Hill, US	1
Gijón, ES	1
Mlocation not on record	1
Uppsala, SE	1
Adam Mickiewicz University in Poznańlocation not on record	1
Bardejov, SK	1

27 institutions · 81 of 97 vouchered records shown · 16 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)