Amanita diemii

Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records105

Data sources7

Biological traits0

DNA specimens2

eDNA detections31

Sources7 archives

Databases and archives Amanita diemii's data was compiled from.

GBIFGlobal Biodiversity Information Facility105 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF105 records

Environmental DNA2 datasets · 3 countries31 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita diemii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections31

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKY462705.1 ↗522 bpChile

ACGT

GCATGTGCACACTGCCTCTGTTGCTTGTTTCTTCATTCTCTCCACTTGTGCACTGCTTGTAGGCAGCCTGGCACTGTTCAGGTTGTCTAT …

Amanita diemii voucher MES-994 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type105 records

Wild obs. + sensor96

Museum / vouchered9

Origin

Native2

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 39≤1 km 21≤10 km 8>10 km 7

75 georeferenced · 21 without coordinates

Open the mapobservation + sensor96

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
IMBIVlocation not on record	4
Universidad Austral de Chilelocation not on record	2
Royal Ontario Museum, TRTC Fungariumlocation not on record	1
Philadelphia, US	1
FLASlocation not on record	1

5 institutions · 9 of 9 vouchered records shown

09Environmental DNA31 detections

Where the DNA of Amanita diemii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.45 3.20–6.55

Conductivity27.0 µS/cm 12.0–285

Organic carbon1.38 % 0.005–4.69

Water content6.93 % 1.23–17.4

Nitrate-N1.00 mg/kg 0.122–12.0

Phosphorus4.00 mg/kg 2.00–626

Clay14.1 % 1.94–32.3

Sand73.7 % 48.8–97.1

Depth0 m 0–0.2

SoilKurosolCalcarosolChromosolKandosolSodosolTenosols

26 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 11.9–24.6

Seasonal swing summer↔winter12.4 °C

Max temp (day)20.0 °C 13.9–30.2

Min temp (night)9.80 °C 7.90–18.7

Precipitation95.3 mm/mo 26.3–123

Air humidity58.7 % 52.0–59.7

Moisture balance-14.9 mm/mo

Vapour deficit700 Pa 561–1,566

Wind speed2.60 m/s

Cloud cover24.9 % 13.2–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)