Amanita crenulata

Peck · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records903

Data sources9

Biological traits0

DNA specimens11

eDNA detections12

Sources9 archives

Databases and archives Amanita crenulata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility903 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF903 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI11 specimens

01Narrative

Amanita crenulata, also known as the poison champagne amanita, is a species of fungus that is very common in the Northeast United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition2 compounds

Compounds documented for Amanita crenulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Aminoacids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Ibotenic Acid		present	LOTUS
Muscimol		present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita crenulata has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes2

GenBank sequences10

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP796176.1 ↗610 bpCanada · 1991

ACGT

CATTATTGAAATAAAACACAGGCAAGGGGGGAGGTGGTTGTAGCTGGCCTCTAGGGGCATGTGCACACTGTCTTTTACTTGCTTGTCTTT …

Amanita crenulata voucher CMMF001591 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type903 records

Wild obs. + sensor850

Museum / vouchered53

Range

Area of Occupancy AOO2 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 413≤1 km 84≤10 km 102>10 km 72

671 georeferenced · 179 without coordinates

Open the mapobservation + sensor850

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 3≤1 km 1≤10 km 8>10 km 5

17 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	9
Personal Herbarium of Potter Palmerlocation not on record	8
Université de Montréal Biodiversity Centrelocation not on record	7
Catholic University of Pekinglocation not on record	4
Bernard Price Institute for Palaeontological Researchlocation not on record	4
Durham, US	1
TENN-Flocation not on record	1
Davis and Elkins Collegelocation not on record	1
Ann Arbor, US	1
Personal Herbarium of Cori Conlonlocation not on record	1
Chicago, US	1
Personal Herbarium of David Wasilewskilocation not on record	1

12 institutions · 39 of 53 vouchered records shown · 13 without an institution code

09Environmental DNA12 detections

Where the DNA of Amanita crenulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 13.7–21.9

Seasonal swing summer↔winter24.5 °C

Max temp (day)17.1 °C 17.1–26.7

Min temp (night)10.9 °C 10.9–16.9

Precipitation107 mm/mo 107–127

Air humidity57.5 % 57.3–59.8

Moisture balance42.3 mm/mo -20.7–42.3

Vapour deficit664 Pa 664–1,059

Wind speed2.80 m/s 2.10–2.80

Cloud cover45.4 % 37.7–45.4

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)