Amanita constricta

Thiers & Ammirati · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records595

Data sources7

Biological traits0

DNA specimens10

eDNA detections35

Sources7 archives

Databases and archives Amanita constricta's data was compiled from.

GBIFGlobal Biodiversity Information Facility595 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF595 records

Environmental DNA2 datasets · 1 countries35 detections

DNA & barcodingBOLD · NCBI10 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita constricta has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes2

GenBank sequences10

eDNA detections35

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ271424.1 ↗255 bpUSA · 1956

ACGT

GAACGCATCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGGGTCATTAAACTATCGAAACACCTTTCTTTGGGGGGGTGTTT …

Amanita constricta isolate MICH CIB A. H. Smith 56317 voucher MICH:191329 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type595 records

Wild obs. + sensor489

Museum / vouchered106

Range

Area of Occupancy AOO1 632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 235≤1 km 54≤10 km 73>10 km 39

401 georeferenced · 88 without coordinates

Open the mapobservation + sensor489

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤1 km 13≤10 km 28

41 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	45
WTUlocation not on record	33
Denver, US	4
Chicago, US	4
California State University, East Baylocation not on record	3
St. Paul, US	3
Santa Cruz, US	3
Private Collection of Autumn Anglinlocation not on record	1
Colorado State Universitylocation not on record	1

9 institutions · 97 of 106 vouchered records shown · 8 without an institution code

09Environmental DNA35 detections

Where the DNA of Amanita constricta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 10.8–10.8

Seasonal swing summer↔winter8.30 °C

Max temp (day)13.2 °C

Min temp (night)9.10 °C

Precipitation340 mm/mo 204–340

Air humidity65.5 %

Moisture balance288 mm/mo 256–288

Vapour deficit445 Pa

Wind speed2.40 m/s

Cloud cover44.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)