Amanita cokeri — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records536

Data sources9

Biological traits0

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Amanita cokeri's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility536 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS45 compounds

Occurrence & distributionGBIF536 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Amanita cokeri, commonly known as Coker's amanita and solitary lepidella, is a mushroom in the family Amanitaceae. The mushroom is poisonous. First described as Lepidella cokeri in 1928, it was transferred to the genus Amanita in 1940.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition45 compounds

Compounds documented for Amanita cokeri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Proanthocyanins8

Cinnamic acid amides4

Phthalide derivatives3

Flavan-3-ols2

Purine alkaloids2

Documented compounds45 total

Compound	Amount	Source
(3S,8S,9S,10R,13R,14S,17R)-17-((E,2S,5S)-5-Ethyl-6-methylhept-3-en-2-yl)-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta(a)phenanthren-3-ol	present	NPASS
4,5,6-Trihydroxy-7-methylphthalide	present	NPASS
4,6-Dihydroxy-5-methoxy-7-methyl-1,3-dihydroisobenzofuran	present	NPASS
7-Methyl-1,3-dihydro-2-benzofuran-4,5,6-triol	present	NPASS
8,8'-Methylenebiscatechin	present	NPASS
AEMOLEFTQBMNLQ-FOSXNRGSSA-N	present	NPASS
alpha-Catechin	present	NPASS
Caffeine	present	NPASS
Catechin	present	NPASS
Choline	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita cokeri has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK580746.1 ↗622 bpUSA · 2000

ACGT

CGTAGGTGACCTGCGGAAGGATCATTATTGAGTGAAATTGGCTTAGAGACTGTTGCTGGCTCTTTTGGGAGCATGTGCACGTCTTTTTGC …

Amanita cokeri isolate 712 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type536 records

Wild obs. + sensor377

Museum / vouchered159

Range

Area of Occupancy AOO1 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 165≤1 km 46≤10 km 34>10 km 40

285 georeferenced · 92 without coordinates

Open the mapobservation + sensor377

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 16≤1 km 14≤10 km 44>10 km 5

79 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence159

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	27
Durham, US	24
Bernard Price Institute for Palaeontological Researchlocation not on record	23
Davis and Elkins Collegelocation not on record	15
Blacksburg, US	11
Chicago, US	11
Zapopan, MX	8
Champaign, US	4
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	4
Bronx, US	4
Osaka, JP	3
Chapel Hill, US	3
Nagatoro-machi, Chichibu-gun, JP	2
Colorado State Universitylocation not on record	2
ILLSlocation not on record	2
FLASlocation not on record	2
Ciudad de México, MX	2
Mexico City, MX	2
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	1
Mexico City, MX	1
Denver, US	1
Tampa, US	1
Vancouver, CA	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
Burlington, US	1
Asheville, US	1
Durango, MX	1
Mexico City, MX	1

28 institutions · 159 of 159 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Amanita cokeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 14.8–14.8

Seasonal swing summer↔winter6.50 °C

Max temp (day)18.9 °C

Min temp (night)9.10 °C

Precipitation355 mm/mo

Air humidity67.0 %

Moisture balance237 mm/mo

Vapour deficit553 Pa

Wind speed0.8 m/s

Cloud cover30.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.