Amanita caesareoides

Lj.N.Vassiljeva · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records185

Data sources8

Biological traits0

DNA specimens16

eDNA detections111

Sources8 archives

Databases and archives Amanita caesareoides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI111 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF185 records

Environmental DNA2 datasets · 2 countries111 detections

DNA & barcodingBOLD · NCBI16 specimens

01Narrative

Amanita caesareoides is a species of Amanita from China, Korea, and Japan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita caesareoides has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes2

GenBank sequences10

eDNA detections111

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP890087.1 ↗559 bpSouth Korea

ACGT

CATTATTGGAATGAAATATCTAGCAAGAGGCTGTTGCTGTTGCTGGGCACTAGCAATGTGCACGCCTTTTGTGGAAAAATAAACCCTTAG …

Amanita caesareoides voucher KA14-0772 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type185 records

Wild obs. + sensor152

Museum / vouchered33

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 56≤1 km 32≤10 km 7>10 km 24

119 georeferenced · 33 without coordinates

Open the mapobservation + sensor152

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Institute of Biological Resourceslocation not on record	5
Bando, JP	3
TENN-Flocation not on record	1

3 institutions · 9 of 33 vouchered records shown · 18 without an institution code

09Environmental DNA111 detections

Where the DNA of Amanita caesareoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found111

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 111 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.40 °C 9.40–9.40

Seasonal swing summer↔winter32.7 °C

Max temp (day)12.5 °C

Min temp (night)5.90 °C

Precipitation98.2 mm/mo

Air humidity58.5 %

Moisture balance-2.20 mm/mo

Vapour deficit488 Pa

Wind speed3.70 m/s

Cloud cover48.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 100 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)