Amanita brunnescens

G.F.Atk. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records2 925

Data sources8

Biological traits0

DNA specimens19

eDNA detections1 099

Sources8 archives

Databases and archives Amanita brunnescens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 925 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 099 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 925 records

Environmental DNA3 datasets · 5 countries1 099 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceNCBI58 Mbp

01Narrative

Amanita brunnescens, also known as the brown American star-footed amanita or cleft-footed amanita is a native North American mushroom of the large genus Amanita. Originally presumed to be the highly toxic Amanita phalloides (the death cap) by renowned American mycologist Charles Horton Peck, it was described and named by George F. Atkinson of Cornell University. He named it after the fact that it bruised brown. It differs from the death cap by its fragile volva and tendency to bruise brown. It is considered probably poisonous.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita brunnescens has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes3

GenBank sequences10

eDNA detections1 099

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPZ387659.1 ↗631 bpMexico · 2021

ACGT

CATTATTGAACGAAAACGGGTGGAAAGGTGTCGTGGCTTGAATGAGCATGTGCACGTCTTTTGCTGCTTATTTCATTCGTCTTTCCTCCT …

Amanita brunnescens voucher SecD3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

06Genome at a glanceNCBI

The complete instruction manual Amanita brunnescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size57 560 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Amanita brunnescens0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 925 records

Wild obs. + sensor1 372

Museum / vouchered1 553

Range

Area of Occupancy AOO6 812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 456≤1 km 172≤10 km 286>10 km 137

1 051 georeferenced · 321 without coordinates

Open the mapobservation + sensor1 372

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 7≤1 km 51≤10 km 131>10 km 14

203 georeferenced · 1 350 without coordinates

Open the institutions mapphysical evidence1 553

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	59
Chicago, US	50
Davis and Elkins Collegelocation not on record	39
Ann Arbor, US	24
Toronto, CA	20
Blacksburg, US	19
Bronx, US	19
Université de Montréal Biodiversity Centrelocation not on record	19
Durham, US	16
WTUlocation not on record	15
Bernard Price Institute for Palaeontological Researchlocation not on record	15
FLASlocation not on record	15
St. Paul, US	13
Acadia Universitylocation not on record	10
Catholic University of Pekinglocation not on record	7
ILLSlocation not on record	6
Denver, US	5
Chapel Hill, US	5
Asheville, US	4
Champaign, US	3
Colorado State Universitylocation not on record	2
Mexico City, MX	2
Durango, MX	2
CA	2
Baton Rouge, US	2
Ciudad de México, MX	1
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	1
Paris, FR	1
Laramie, US	1
Vancouver, CA	1
Helsinki, FI	1
US	1
Tampa, US	1
McWane Science Centerlocation not on record	1

34 institutions · 382 of 1 553 vouchered records shown · 1 167 without an institution code

09Environmental DNA1 099 detections

Where the DNA of Amanita brunnescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 099

Studies independent surveys3

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 099 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.3 °C 7.00–29.0

pH5.60 3.10–9.00

Conductivity54.0 µS/cm 6.00–115,200

Organic carbon1.84 % 0.003–16.3

Water content10.8 % 0.305–117

Nitrate-N5.00 mg/kg 0.006–233

Phosphorus10.0 mg/kg 1.00–400

Clay14.6 % 0.91–70.0

Sand69.4 % 0–99.1

Depth0 m 0–1.02

SoilKurosolPodosolTenosolVertosolDermosolsCalcarosol

1 050 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 9.10–23.0

Seasonal swing summer↔winter12.0 °C

Max temp (day)19.4 °C 12.9–28.8

Min temp (night)10.8 °C 4.90–18.0

Precipitation60.3 mm/mo 21.9–123

Air humidity58.2 % 50.0–63.0

Moisture balance-30.4 mm/mo -131–53.8

Vapour deficit741 Pa 423–1,350

Wind speed3.00 m/s 1.90–4.90

Cloud cover21.0 % 9.80–34.7

CHELSA 1981–2010, ~9 km grid, at location & month of 1 074 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amanita brunnescens

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 925 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 925 records