Amanita breckonii

Thiers & Ammirati · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records27

Data sources9

Biological traits0

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Amanita breckonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Amanita breckonii is a species of agaric fungus in the genus Amanita. It is known from California and Washington, where it associates with Monterey pine, ponderosa pine, and spruce. The species was described as new to science in 1982 by mycologists Harry Delbert Thiers and Joseph Ammirati. The holotype specimen was collected in 1966 on the campus of San Francisco State University by then graduate student Gary Breckon, for whom the species is named.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita breckonii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKR919756.1 ↗204 bpUSA · 1982

ACGT

GGGGGGGGAGGTGGTTGTAGCTGGCCCCTTAGGGGCATGTGCACACTGTCTCTCTCTCTTGCTTGTTTTTTTAAAATTCTTTCCACTTGT …

Amanita breckonii voucher RET 174-7 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7★ITS1

fungal barcode

08Occurrence & distribution

Record type27 records

Wild obs. + sensor23

Museum / vouchered4

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 12≤1 km 6>10 km 4

22 georeferenced · 1 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Université de Montréal Biodiversity Centrelocation not on record	1
Personal Herbarium of Joanne Schwartzlocation not on record	1

2 institutions · 2 of 4 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Amanita breckonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

On Soil; Pine forest, dead from bark beetle;…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 12.6–13.4

Seasonal swing summer↔winter15.6 °C

Max temp (day)16.4 °C 14.8–18.0

Min temp (night)10.5 °C 8.70–12.3

Precipitation101 mm/mo 83.8–118

Air humidity57.7 % 57.4–58.0

Moisture balance-3.90 mm/mo -31.5–23.7

Vapour deficit692 Pa 658–725

Wind speed5.50 m/s 5.30–5.80

Cloud cover38.9 % 37.1–40.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)