Amanita beckeri

Huijsman · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records126

Data sources9

Biological traits0

DNA specimens1

eDNA detections2

Sources9 archives

Databases and archives Amanita beckeri's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility126 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF126 records

Environmental DNA2 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Amanita beckeri or Becker's ringless amanita is a species of Amanita from Europe. It is named after Georges Becker (1905-1994), who identified it.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita beckeri has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences6

eDNA detections2

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPP375715.1 ↗515 bpFrance · 2017

ACGT

CATTATTGAATGAAACTTCTGGCTGGATGTTGTTGTGCTGGCCCTTCTGGGCAATGTGCACACCTCTGGTCATTTGTTTCTTCTGTTCCA …

Amanita beckeri voucher GC17092307 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type126 records

Wild obs. + sensor80

Museum / vouchered44

Other2

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 4≤1 km 3≤10 km 30>10 km 3

40 georeferenced · 40 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 3≤1 km 15≤10 km 9

27 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WU-MYClocation not on record	16
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	6
San Sebastián, ES	4
GJOlocation not on record	3
BDBClocation not on record	2
Chicago, US	2
Bardejov, SK	1
LDlocation not on record	1
Slovenian Forestry Institutelocation not on record	1
Göteborg, SE	1
Helsinki, FI	1

11 institutions · 38 of 44 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Amanita beckeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 9.20–14.8

Seasonal swing summer↔winter24.9 °C

Max temp (day)16.4 °C 13.8–19.1

Min temp (night)6.90 °C 3.60–10.2

Precipitation69.5 mm/mo 53.1–85.9

Air humidity56.2 % 52.8–59.5

Moisture balance-2.90 mm/mo -22.8–16.9

Vapour deficit659 Pa 625–693

Wind speed2.60 m/s 2.50–2.70

Cloud cover36.3 % 32.7–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)