Amanita augusta

Bojantchev & R.M.Davis · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records2 973

Data sources9

Biological traits0

DNA specimens2

eDNA detections83

Sources9 archives

Databases and archives Amanita augusta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 973 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI83 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 973 records

Environmental DNA2 datasets · 5 countries83 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Amanita augusta is a small tannish-brown mushroom with cap colors bright yellow to dark brown and various combinations of the two colors. The mushroom is often recognizable by the fragmented yellow remnants of the universal veil. This mushroom grows year-round in the Pacific Northwest but fruiting tends to occur in late fall to mid-winter. The fungus grows in an ectomycorrhizal relationship with hardwoods and conifers often in mixed woodlands.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita augusta has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections83

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPZ271409.1 ↗296 bpUSA · 1937

ACGT

GAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATATCTCAAAAAGTTTGTGCTTTTTTGGCATAA …

Amanita augusta isolate MICH CIB A. H. Smith 8538 voucher MICH:188214 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type2 973 records

Wild obs. + sensor2 956

Museum / vouchered17

Range

Area of Occupancy AOO4 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 1 370≤1 km 452≤10 km 384>10 km 326

2 532 georeferenced · 424 without coordinates

Open the mapobservation + sensor2 956

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	2
WTUlocation not on record	2
California State University, East Baylocation not on record	2
Kathmandu, NP	1
Bronx, US	1
Chicago, US	1

6 institutions · 9 of 17 vouchered records shown · 8 without an institution code

09Environmental DNA83 detections

Where the DNA of Amanita augusta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found83

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 83 detections have coordinates

Open the map5 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.80 °C 3.80–9.40

Seasonal swing summer↔winter15.6 °C

Max temp (day)8.00 °C 8.00–13.9

Min temp (night)-2.30 °C -2.30–5.90

Precipitation15.0 mm/mo 15.0–98.2

Air humidity59.9 % 53.8–60.9

Moisture balance-46.5 mm/mo -70.3–-2.20

Vapour deficit322 Pa 322–488

Wind speed1.90 m/s 1.60–3.70

Cloud cover26.0 % 26.0–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 83 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amanita augusta

At a glance

Sources9 archives

At a glance

Record type2 973 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 973 records