Amanita atkinsoniana

Coker · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records135

Data sources9

Biological traits0

DNA specimens4

eDNA detections2

Sources9 archives

Databases and archives Amanita atkinsoniana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility135 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF135 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Amanita atkinsoniana, also known as the Atkinson's amanita, is a species of fungus in the family Amanitaceae. It is found in the northeastern, southeastern, and southern United States as well as southern Canada, where it grows solitarily or in small groups on the ground in mixed woods. The fruit body is white to brownish, with caps that measure up to 12.5 cm in diameter, and stems up to 20 cm long and 2.5 cm thick. The surface of the cap is covered with reddish-brown to grayish-brown conical warts. The stem has a bulbous base covered with grayish-brown scales. The fruit bodies smell faintly like bleaching powder. Although not known to be poisonous, the mushroom is not recommended for consumption.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita atkinsoniana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH910570.1 ↗342 bpUSA · 2015

ACGT

TGATAAGAGAAATAAAATACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA …

Amanita atkinsoniana voucher NAMA 2015-339 Mushroom Observer # 247302 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6★ITS1

fungal barcode

08Occurrence & distribution

Record type135 records

Wild obs. + sensor79

Museum / vouchered56

Range

Area of Occupancy AOO380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 7≤1 km 12≤10 km 28>10 km 10

57 georeferenced · 22 without coordinates

Open the mapobservation + sensor79

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤1 km 16≤10 km 15>10 km 2

33 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chapel Hill, US	16
Chicago, US	9
Blacksburg, US	5
Durango, MX	5
Ann Arbor, US	4
Davis and Elkins Collegelocation not on record	3
TENN-Flocation not on record	3
Odawara, JP	2
Bronx, US	2
Université de Montréal Biodiversity Centrelocation not on record	2
Mexico City, MX	1
FLASlocation not on record	1
McWane Science Centerlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

14 institutions · 55 of 56 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Amanita atkinsoniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 21.1–21.1

Seasonal swing summer↔winter19.7 °C

Max temp (day)25.8 °C

Min temp (night)17.0 °C

Precipitation162 mm/mo

Air humidity66.1 %

Moisture balance36.2 mm/mo

Vapour deficit845 Pa

Wind speed1.20 m/s

Cloud cover29.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)