Amanita aprica

J.Lindgr. & Tulloss · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records1 180

Data sources9

Biological traits0

DNA specimens2

eDNA detections124

Sources9 archives

Databases and archives Amanita aprica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 180 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI124 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 180 records

Environmental DNA5 datasets · 1 countries124 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Amanita aprica, also known as the sunshine amanita, is a species of fungus in the family Amanitaceae. Described as new to science in 2005, the species is found in the Pacific Northwest region of North America, where it grows in a mycorrhizal association with Douglas-fir and pines. The species has a yellow to orange cap with warty remnants of the whitish universal veil. The gills are pale, as is the stipe, which may be wider at the base. A skirt-like ring may be present, especially on younger specimens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita aprica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections124

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPZ271403.1 ↗321 bpUSA · 1954

ACGT

GAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTGTCAAAACATGCACTTGAGTGTGTTTTG …

Amanita aprica isolate MICH CIB Cooke 29510 voucher MICH:190871 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type1 180 records

Wild obs. + sensor1 150

Museum / vouchered30

Range

Area of Occupancy AOO3 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 546≤1 km 142≤10 km 121>10 km 127

936 georeferenced · 214 without coordinates

Open the mapobservation + sensor1 150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤1 km 3≤10 km 7>10 km 1

11 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	13
Vancouver, CA	9
Chicago, US	2
Santa Cruz, US	1

4 institutions · 25 of 30 vouchered records shown · 3 without an institution code

09Environmental DNA124 detections

Where the DNA of Amanita aprica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found124

Studies independent surveys5

Countries1

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 124 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 20.8–20.8

Seasonal swing summer↔winter19.0 °C

Max temp (day)28.2 °C

Min temp (night)13.2 °C

Precipitation4.30 mm/mo

Air humidity45.6 %

Moisture balance-158 mm/mo

Vapour deficit1,334 Pa

Wind speed1.70 m/s

Cloud cover13.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 122 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amanita aprica

At a glance

Sources9 archives

At a glance

Record type1 180 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 180 records