Amanita albocreata

(G.F.Atk.) E.-J.Gilbert · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records114

Data sources8

Biological traits0

DNA specimens3

eDNA detections26

Sources8 archives

Databases and archives Amanita albocreata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF114 records

Environmental DNA3 datasets · 3 countries26 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Amanita albocreata, also called the ringless panther or the ringless panther amanita, is a species of fungus in the family Amanitaceae. It was discovered in 1944, by William Murrill. It is commonly found in northeastern United States and southeastern Canada and elsewhere in North America. This species, that grows about 5 to 15 centimeters in length, is doubted to be fatally toxic. It normally grows between the rainy months of June and August.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita albocreata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences10

eDNA detections26

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP796151.1 ↗612 bpCanada · 1992

ACGT

CATTATTGAAATAAAACTCAGGCAGGGGGACGGAGGTGGTTGTAGCTGGCCCCCTAATAAAGGGCATGTGCACACTGTCTCTTTCTCTTG …

Amanita albocreata voucher CMMF001731 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type114 records

Wild obs. + sensor67

Museum / vouchered47

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 16≤1 km 8≤10 km 25>10 km 3

52 georeferenced · 15 without coordinates

Open the mapobservation + sensor67

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 2≤10 km 8>10 km 1

11 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	8
Université de Montréal Biodiversity Centrelocation not on record	8
Davis and Elkins Collegelocation not on record	4
TENN-Flocation not on record	3
Chicago, US	2
Catholic University of Pekinglocation not on record	2
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	1
Personal Herbarium of John Plischkelocation not on record	1
Mexico City, MX	1
Toronto, CA	1

10 institutions · 31 of 47 vouchered records shown · 15 without an institution code

09Environmental DNA26 detections

Where the DNA of Amanita albocreata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys3

Countries3

Verifiable raw sequence linked21

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map3 countries0

PalearcticNearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 14.6–17.5

Seasonal swing summer↔winter17.9 °C

Max temp (day)24.7 °C 19.7–24.7

Min temp (night)9.80 °C 9.30–9.80

Precipitation21.7 mm/mo 21.7–129

Air humidity46.7 % 46.7–60.5

Moisture balance-143 mm/mo -143–15.9

Vapour deficit1,073 Pa 611–1,073

Wind speed1.50 m/s 1.50–1.90

Cloud cover27.5 % 27.5–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)