Amanita abrupta

Peck · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Amanitaceae/Amanita

At a glance

Occurrence records603

Data sources9

Biological traits0

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Amanita abrupta's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility603 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF603 records

DNA & barcodingNCBIsequences

01Narrative

Amanita abrupta, commonly known as the American abrupt-bulbed amanita or the American abrupt-bulbed lepidella, is a species of fungus in the family Amanitaceae. Named for the characteristic shape of its fruit bodies, this white Amanita has a slender stem, a cap covered with conical white warts, and an "abruptly enlarged" swollen base. This terrestrial species grows in mixed woods in eastern North America and eastern Asia, where it is thought to exist in a mycorrhizal relationship with a variety of both coniferous and deciduous tree species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition18 compounds

Compounds documented for Amanita abrupta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Ophiobolane sesterterpenoids8

Aminoacids4

Unsaturated fatty acids1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3S,4R,7R,8E,11S,12R)-4-hydroxy-1,4-dimethyl-12-[(2S)-6-methylhept-5-en-2-yl]-6-oxotricyclo[9.3.0.03,7]tetradec-8-ene-8-carbaldehyde	present	NPASS
(S)-2-Amino-4,5-hexadienoic acid	present	LOTUS
(S)-2-Methyl-4-pentenoic acid	present	LOTUS
(Z,2S)-2-amino-5-chloro-6-hydroxyhex-4-enoic acid	present	LOTUS
6-epi-Ophiobolin A	present	NPASS
6-epiophiobolin I	present	NPASS
Anhydroepiophiobolin A	present	NPASS
Anhydroophiobolin A	present	NPASS
JNYWQVTXIGGOTC-QATDTHCRSA-N	present	NPASS
L-propargylglycine zwitterion	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amanita abrupta has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPP796147.1 ↗434 bpCanada · 2011

ACGT

GGAGCTCTTGATGTTCTATGTCTTTACATTATACACAGTTTGTATGTCTAGAGAATGATGGGATTAGAAATAAATACAACTTTCAACAAC …

Amanita abrupta voucher HRL0780 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type603 records

Wild obs. + sensor420

Museum / vouchered183

Range

Area of Occupancy AOO1 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 114≤1 km 58≤10 km 66>10 km 61

299 georeferenced · 121 without coordinates

Open the mapobservation + sensor420

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 5≤1 km 30≤10 km 30>10 km 7

72 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence183

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	25
Chicago, US	25
Chapel Hill, US	14
Osaka, JP	14
Catholic University of Pekinglocation not on record	14
Davis and Elkins Collegelocation not on record	11
Bernard Price Institute for Palaeontological Researchlocation not on record	9
Tomioka, JP	8
Bronx, US	8
Bando, JP	8
Nagatoro-machi, Chichibu-gun, JP	7
Chiba, JP	7
Blacksburg, US	6
Université de Montréal Biodiversity Centrelocation not on record	6
Champaign, US	3
FLASlocation not on record	3
Ann Arbor, US	3
Colorado State Universitylocation not on record	3
ILLSlocation not on record	2
Denver, US	1
Laramie, US	1
National Institute of Biological Resourceslocation not on record	1
Asheville, US	1
Durham, US	1

24 institutions · 181 of 183 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)