Amalaraeus penicilliger

(Grube, 1851) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Siphonaptera/Ceratophyllidae/Amalaraeus

At a glance

Occurrence records86

Data sources5

Biological traits0

DNA specimens11

eDNA detections14

Sources5 archives

Databases and archives Amalaraeus penicilliger's data was compiled from.

GBIFGlobal Biodiversity Information Facility86 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF86 records

Environmental DNA1 datasets · 3 countries14 detections

DNA & barcodingBOLD11 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amalaraeus penicilliger has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes2

eDNA detections14

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)2.5%

Haplotypes1

BINs2

Where individuals differ — all 39 variable positions, in barcode order

5Gmostly conserved

32Tmostly conserved

55Avariable

67Cvariable

70Amostly conserved

74Tmostly conserved

109Gmostly conserved

115Cmostly conserved

202Cmostly conserved

229Tmostly conserved

241Cvariable

253Cvariable

256Tmostly conserved

265Cmostly conserved

266Cvariable

269Tmostly conserved

280Gmostly conserved

298Gvariable

301Avariable

304Gvariable

325Tmostly conserved

391Gmostly conserved

397Amostly conserved

415Avariable

418Avariable

445Tmostly conserved

448Avariable

478Avariable

490Tmostly conserved

529Tmostly conserved

532Gvariable

538Amostly conserved

550Amostly conserved

580Cmostly conserved

586Cvariable

604Avariable

607Tmostly conserved

616Cmostly conserved

628Cvariable

TGGTGCATGATCCGGAATGATTGGAACTTCCTTAAGTATTTTAATTCGAACTGAATTAGGTCAACCCGGATCTTTAATTGGAGATGATCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Orchopeas caedenssame family10.8%Orchopeas agilissame family11.2%Tarsopsylla octodecimdentatasame family11.4%Ceratophyllus wuisame family11.5%Megabothris quirinisame family11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type86 records

Wild obs. + sensor3

Museum / vouchered83

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy1% within 1 km

≤1 km 1≤10 km 17>10 km 55

73 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provo, US	70
Harold Winfred Manter Laboratory of Parasitologylocation not on record	7
Cambridge, US	2

3 institutions · 79 of 83 vouchered records shown · 3 without an institution code

09Environmental DNA14 detections

Where the DNA of Amalaraeus penicilliger was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map3 countries0

Forest, on Clethrionomys glareolus

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.00 °C -5.00–10.6

Seasonal swing summer↔winter29.3 °C

Max temp (day)10.0 °C -1.10–15.7

Min temp (night)2.90 °C -8.40–4.90

Precipitation42.6 mm/mo 13.2–77.7

Air humidity64.3 % 45.7–70.3

Moisture balance17.5 mm/mo -95.2–46.9

Vapour deficit410 Pa 184–827

Wind speed4.50 m/s 2.10–4.50

Cloud cover57.1 % 24.1–62.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)