Amaeana occidentalis

(Hartman, 1944) · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Terebellidae/Amaeana

At a glance

Occurrence records1 352

Data sources7

Biological traits2

DNA specimens21

eDNA detections21

Sources7 archives

Databases and archives Amaeana occidentalis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility610 records↗

OBISOcean Biodiversity Information System742 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 352 records

Environmental DNA1 datasets · 3 countries21 detections

DNA & barcodingBOLD21 specimens

01Narrative

Amaeana occidentalis is een borstelworm uit de familie Terebellidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Amaeana occidentalis werd in 1944 voor het eerst wetenschappelijk beschreven door Hartman.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amaeana occidentalis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs5

Marker genes1

eDNA detections21

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 76% of positions are identical in every specimen.

Where individuals differ — all 160 variable positions, in barcode order

2Amostly conserved

10Cmostly conserved

22Amostly conserved

25Tmostly conserved

31Tmostly conserved

34Tmostly conserved

37Amostly conserved

38Cmostly conserved

46Gmostly conserved

55Tmostly conserved

56Tmostly conserved

61Amostly conserved

64Cmostly conserved

67Cmostly conserved

68Gmostly conserved

76Tmostly conserved

79Tmostly conserved

85Cmostly conserved

91Amostly conserved

94Cmostly conserved

95Cmostly conserved

100Amostly conserved

106Cmostly conserved

112Cmostly conserved

115Tmostly conserved

124Cmostly conserved

127Gmostly conserved

133Amostly conserved

136Tmostly conserved

139Amostly conserved

141Tmostly conserved

142Cmostly conserved

143Cmostly conserved

145Tmostly conserved

157Tmostly conserved

158Cmostly conserved

160Tmostly conserved

163Amostly conserved

169Amostly conserved

170Gmostly conserved

172Amostly conserved

175Amostly conserved

181Tmostly conserved

184Gmostly conserved

190Amostly conserved

193Cmostly conserved

197Cmostly conserved

199Tmostly conserved

202Cmostly conserved

206Tmostly conserved

212Cmostly conserved

214Amostly conserved

217Amostly conserved

226Tmostly conserved

232Tmostly conserved

235Cmostly conserved

238Tmostly conserved

247Tmostly conserved

250Tmostly conserved

259Cmostly conserved

262Amostly conserved

263Cmostly conserved

268Tmostly conserved

271Amostly conserved

278Cmostly conserved

281Cmostly conserved

283Tmostly conserved

286Cmostly conserved

289Tmostly conserved

290Cmostly conserved

292Cmostly conserved

295Amostly conserved

298Cmostly conserved

304Tmostly conserved

319Gvariable

322Cmostly conserved

325Amostly conserved

334Amostly conserved

337Cmostly conserved

343Cmostly conserved

346Tmostly conserved

347Tmostly conserved

358Cmostly conserved

367Cmostly conserved

373Cmostly conserved

376Tmostly conserved

379Amostly conserved

382Tmostly conserved

385Cmostly conserved

388Tmostly conserved

391Tmostly conserved

394Tmostly conserved

397Cmostly conserved

400Tmostly conserved

403Amostly conserved

406Cmostly conserved

412Tmostly conserved

415Amostly conserved

421Tmostly conserved

424Tmostly conserved

427Cmostly conserved

428Cmostly conserved

433Amostly conserved

439Tmostly conserved

442Tmostly conserved

448Tmostly conserved

451Amostly conserved

454Cmostly conserved

457Amostly conserved

460Cmostly conserved

463Cmostly conserved

478Amostly conserved

481Tmostly conserved

484Cmostly conserved

485Cmostly conserved

487Tmostly conserved

493Amostly conserved

496Cmostly conserved

499Tmostly conserved

502Amostly conserved

+40 more variable positions not shown

AACCCTTTACTTTATTTTTGGAGTTTGAGGTGGTCTACTAGGAACGTCAATAAGTTTACTAATCCGCGTTGAACTTGGTCAACCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.6%

Haplotypes7

BINs3

Most divergent pair19.3%

N.AmericaOtherAsia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 352 records

Wild obs. + sensor177

Museum / vouchered1 174

Other1

Range

Area of Occupancy AOO1 508 km²

Depth

0–200 m sunlit172

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15.5 m · max 151.8 m · 172 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 176 without coordinates

Open the mapobservation + sensor177

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 102≤1 km 8>10 km 4

114 georeferenced · 1 060 without coordinates

Open the institutions mapphysical evidence1 174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	428
CASlocation not on record	48
Los Angeles, US	40
Instituto de Investigaciones Oceanológicas, Universidad Autónoma de Baja Californialocation not on record	23
Santa Barbara Museum of Natural Historylocation not on record	11
Washington, US	3
Victoria, CA	2
Cambridge, US	1
Universidad Austral de Chilelocation not on record	1
San Nicolás de los Garza, MX	1

10 institutions · 558 of 1 174 vouchered records shown · 49 without an institution code

09Environmental DNA21 detections

Where the DNA of Amaeana occidentalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map3 countries0

Marine subtidalbenthic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 8.20–19.9

Seasonal swing summer↔winter12.0 °C

Max temp (day)12.9 °C 10.7–21.0

Min temp (night)8.70 °C 4.40–18.8

Precipitation197 mm/mo 17.3–212

Air humidity64.4 % 59.4–65.3

Moisture balance116 mm/mo

Vapour deficit457 Pa 378–835

Wind speed3.90 m/s

Cloud cover40.2 % 17.7–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amaeana occidentalis

At a glance

Sources7 archives

Habitat & environment2

At a glance

Record type1 352 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 352 records