Alytes muletensis

(Sanchíz & Adrover, 1979) · species

image placeholder — illustration coming later

Animalia/Chordata/Amphibia/Anura/Alytidae/Alytes

At a glance

Occurrence records106

Data sources10

Biological traits15

DNA specimens6

eDNA detections4

Sources10 archives

Databases and archives Alytes muletensis's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility106 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

Amphibian Species of the WorldAMNHamphibian catalog↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources15 traits

Occurrence & distributionGBIF106 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD6 specimens

Genome at a glanceGoaT2n = 38

01Narrative

The Majorcan midwife toad (Alytes muletensis) (also Mallorcan midwife toad or ferreret in Balearic Catalan and Spanish) is a frog in the family Alytidae (formerly Discoglossidae). It is endemic to the Balearic Island of Majorca in the Mediterranean Sea. An example of Lazarus taxon, the species was first described from fossil remains in 1977, but living animals were discovered in 1979. The species, considered "vulnerable" by the IUCN, is currently restricted to isolated mountain rivers in the island's Serra de Tramuntana and has an estimated population of 500 breeding pairs in the wild. It does exist and reproduce easily in captivity, however. The Majorcan midwife toad is thought to have disappeared from most of the island as a result of the introduction of competitors and predators from the mainland in ancient times. Reintroduction of the species in additional areas has taken place since 1988, with many new breeding populations now well established.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmphiBIO

Size & morphology2

Body mass2.31 g

SVL4 cm

Life cycle & reproduction5

Age at maturity max3 years

Age at maturity min3 years

Litter size max20

Litter size min7

Reproductive output1 /year

Diet & foraging1

Arthropodsyes

Habitat & environment2

Habitat arborealyes

Habitat terrestrialyes

Other traits5

Activity nocturnalyes

Offspring size max7 mm

Offspring size min5.4 mm

Repro larvalyes

Season wet warmyes

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alytes muletensis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P587 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.26%

Haplotypes2

BIN1

Most divergent pair0.34%

Where individuals differ — all 2 variable positions, in barcode order

33Cvariable

519Amostly conserved

GTGGCAATCACACGCTGATTCTTTTCAACTAACCATAAAGATATTGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGGATAGTAGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alytes maurussame genus7.0%Alytes dickhillenisame genus7.4%Alytes obstetricanssame genus10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Alytes muletensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome records38–382n range38median38mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×GoaT · Animal Chromosome Counts Database · GoaT · Amphibian Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Amphibian Karyotype Database — ↗

07Deep time~6.73 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin6.73 Ma TimeTree

StatusExtinct no longer alive anywhere

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Environmentbrackish,freshwater,terrestrial

Life habitamphibious

Dietcarnivore

Motilityactively mobile

Compositionhydroxyapatite

Reproductiondispersal=water

08Occurrence & distribution

Record type106 records

Wild obs. + sensor95

Museum / vouchered5

Fossil4

Other2

Origin

Native1

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 14≤1 km 24≤10 km 8>10 km 23

69 georeferenced · 26 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MUHNAClocation not on record	2
	2
IMEDEAlocation not on record	1

3 institutions · 5 of 5 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Alytes muletensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)