Alyssum montanum
speciesAt a glance
Occurrence records6 587
Data sources10
Biological traits34
DNA specimens16
eDNA detections21
Sources10 archives
Databases and archives Alyssum montanum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 587 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics16 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources34 traits
Occurrence & distributionGBIF6 587 records
Environmental DNA1 datasets · 4 countries21 detections
DNA & barcodingBOLD · NCBI16 specimens
Genome at a glanceCCDB2n = 32
01Narrative
L'Alysson des montagnes ou Passerage des montagnes est une espèce de plantes à fleurs vivaces du genre Alyssum et de la famille des Brassicacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology8
Leaf mass3.49 mg
Leaf size39 mm²
Plant height0.085 m
⚠ sources differ — GIFT: 0.085 m · LEDA: 0.085 m · TRY: 0.212 m
Plant height generative0.15 m
Plant height max0.25 m
Plant height min0.05 m
Seed length2 mm
Seed mass0.607 mg
Life cycle & reproduction12
Deciduousnessevergreen
Dispersal typewind
Flowering endJun
Flowering startApr
Life formsubshrub
Life spanperennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Seed number68
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formshrub
⚠ sources differ — GIFT: shrub · TRY: Herb
Habitat GIFTsand
Mycorrhiza type0.091986564
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)245 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)14.59 mm²/mg
⚠ sources differ — TRY: 14.59 mm²/mg · LEDA: 12.27 mm²/mg · GIFT: 12.27 mm²/mg
Other traits1
Diaspore typeseed
05DNA & barcoding16 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alyssum montanum has left across the world's sequence archives.
At a glance
DNA specimens16
Marker genes2
GenBank sequences10
eDNA detections21
Countries8
The DNA barcodea real sequence read deposited for this species
ACAGAACGACCCGCGAACGAACGATCATCACTCCCGGTGGGCCGGTATCCTAACAGATTCCGTTGCCCGCTGGTTCCGTGGTTTCGCGAA …
Alyssum montanum voucher SAV:297MEA2 clone allele2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★ITS10★ITS2
fungal barcode
06Genome at a glanceCCDB
The complete instruction manual Alyssum montanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidypolyploid inferred
Chromosome records16–482n range32median32mode78records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3245×CCDB · slov-fl · CCDB · iber-fl · CCDB · ipcn-api-dl +7
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Murín A. & Májovský J., 1978: [Report], pp. 376-378. - In: Löve Á. (ed.), IOPB chromosome number reports LXI, Taxon 27 /4.
CCDB · slov-fl — Kelcová M., 2007: [New records in Alyssum], pp. 81. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · slov-fl — Cigáneková V., 2007: [New records in Alyssum], pp. 83. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iber-fl — Recherches sur les liens de parent entre la flore orophile des Alpes et celledes Pyrnes. Kpfer, P.Boissiera23: 3-322(1974).
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Van Loon, J. C. 1980. In Chromosome number reports LXIX. Taxon 29: 718–720.
CCDB · ipcn-api-dl — Anchev, M. E. 1991. Genus Alyssum L. in Bulgarian flora. Pp. 85--117 in. In Evol. Fl. Pl. Florogen., 2. Bulgarian Academy of Sciences, Sofia.
CCDB · ipcn-api-dl — Ancev, M. E. & T. R. Dudley. 1981. In Chromosome number reports LXXIII. Taxon 30: 856.
CCDB · ipcn-api-dl — Iljinskaya, A. P. 1986. Cytotaxonomic analysis of representatives from the section Alyssum, Psilonema (Meyer) Hook. in Benth. et Hook. and Meniocus (Desv.) Hook. of the genus Alyssum L. of the Ukrainian flora. Ukrains'k. Bot. Zurn. 43: 26–30.
CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn75-78 — Murin & Majovsky 1978
CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.
CCDB · book-fedorov — Murin, Vachov.;
CCDB · brass — Dobes et al.
CCDB · brass — Ancev
CCDB · brass — Druskovic & Lovka
CCDB · brass — Mjovsky et al.
CCDB · brass — Murn
CCDB · brass — Contandriopoulos
CCDB · brass — Strid & Franzn
CCDB · brass — Bcher & Larsen
CCDB · brass — Kpfer
CCDB · brass — Manton
CCDB · brass — van Loon & Kieft
CCDB · brass — Dmitrieva
CCDB · brass — Ancev & Dudley
CCDB · brass — Murn & Mjovsky
CCDB · brass — Iljinskaya
CCDB · Cave1958 — Booher & Larsen 1958
CCDB · CromoCat 2015 — Ancev, M. E. (1978a). Karyological study of Bulgarian Campanulaceae. Fitologija 5: 66-74.
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Küpfer, P. (1974). Recherches sur les liens de parenté entre la flore orophile des Alpes et celle des Pyrénées. Boissiera 23: 3- 322.
CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
CCDB · CromoCat 2015 — Ancev, M. E. & Dudley, T. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 856.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
+1 more references
2n 1630×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +5
CCDB · ita-fl — KIEFT B., LOON J.C. - 1978. IOPB chromosome number reports LXII.. Taxon , 27(5/6): 524-525.
CCDB · ita-fl — LA VALVA V. - 1976. Numeri cromosomici per la flora italiana:251-254.. Inform. Bot. Ital. , 8(2): 204-207.
CCDB · iber-fl — Algunas crucferas interesantes para la flora de Granada (Espaa). Morales Torres, C., A. B. Robles Cruz & A. T. Romero Garca.Lazaroa9: 147-157(1988).
CCDB · iber-fl — Recherches sur les liens de parent entre la flore orophile des Alpes et celledes Pyrnes. Kpfer, P.Boissiera23: 3-322(1974).
CCDB · fl-europaea — Bbcher &
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Morales Torres, C., A. B. R. Cruz & A. T. R. García. 1988. Algunos crucíferas interesantes para la flora de Granada (España). Lazaroa 9: 147–157.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — KIEFT, B. & J. C. V. LOON. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · book-ipcn75-78 — Kieft & Loon 1978
CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.
CCDB · brass — Galland
CCDB · brass — Morales Torres et al.
CCDB · brass — Manton
CCDB · brass — Kpfer
CCDB · brass — van Loon
CCDB · brass — Valva
CCDB · brass — Kieft & van Loon
CCDB · brass — Druskovic & Lovka
CCDB · brass — Lovka et al.
CCDB · brass — Ancev
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Kieft, B. & van Loon, J. C. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 524-525.
CCDB · CromoCat 2015 — Küpfer, P. (1974). Recherches sur les liens de parenté entre la flore orophile des Alpes et celle des Pyrénées. Boissiera 23: 3- 322.
CCDB · CromoCat 2015 — Lovka, M., Susnik, F., Löve, A. & Löve, D. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIV]. Taxon 20(5/6): 788-791.
CCDB · CromoCat 2015 — Valva, V., La (1976). Numeri cromosomici per la flora italiana: 251-254. Inf. Bot. Ital. 8: 204-207.
CCDB · CromoCat 2015 — Jaretzky, R. (1932). Beizichungen zwischen chromosomenzahl und systematik bei den Cruciferen. Jahrb. Wiss. Bot. 76: 485-527.
CCDB · CromoCat 2015 — Manton, I. (1932a). Introduction to the general cytology of the Cruciferae. Ann. Bot. (London) 46(183): 509-556.
CCDB · CromoCat 2015 — Quézel, P. (1957). Peuplement végétal des hautes montagnes de l'Afrique du Nord. Encycl. Biogéogr. Ecol. 10(137): 1-463.
2n 483×CCDB · brass · CCDB · CromoCat 2015
CCDB · brass — Druskovic & Lovka
CCDB · brass — Iljinskaya
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
n 85×CCDB · ipcn-api-dl · CCDB · brass · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · brass — Quzel
CCDB · brass — Galland
CCDB · brass — Jaretzky
CCDB · CromoCat 2015 — Küpfer, P. (1972a). Cytotaxonomie et cytogéographie de quelques groupes d'orophytes du bassin occidental de la Méditerranée et des Alpes. Compt. Rend. Acad. Sci. Paris 275: 1753-1756.
n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 241×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type6 587 records
Wild obs. + sensor5 304
Museum / vouchered1 278
Cultivated / captive2
Other3
Origin
Native67
Introduced2
Range
Area of Occupancy AOO9 488 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy33% within 1 km
≤100 m 528≤1 km 756≤10 km 2 648>10 km 10
3 942 georeferenced · 1 362 without coordinates
Open the mapobservation + sensor5 304
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 63≤1 km 229≤10 km 244>10 km 6
542 georeferenced · 736 without coordinates
Open the institutions mapphysical evidence1 278
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 1
1 georeferenced · 1 without coordinates
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions49 of 94 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| MAlocation not on record | 141 |
| Uniwersytet Wrocławskilocation not on record | 109 |
| Adam Mickiewicz University in Poznańlocation not on record | 88 |
| Vitoria, ES | 69 |
| Zürich, CH | 52 |
| BFLlocation not on record | 48 |
| Bern, CH | 48 |
| LDlocation not on record | 43 |
| Entomological Society of Latvialocation not on record | 32 |
| BClocation not on record | 31 |
| Zürich, CH | 27 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 27 |
| College of the Atlantic, Museumlocation not on record | 27 |
| San Sebastián, ES | 26 |
| GJOlocation not on record | 26 |
| BRNUlocation not on record | 26 |
| Wlocation not on record | 21 |
| Madrid, ES | 21 |
| Berlin, DE | 21 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 21 |
| Barcelona, ES | 21 |
| Provincia di Livornolocation not on record | 15 |
| Jaén, ES | 15 |
| València, ES | 13 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 12 |
| Uniwersytet Jagiellońskilocation not on record | 12 |
| Salamanca, ES | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 9 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 9 |
| CJBGlocation not on record | 8 |
| Görlitz, DE | 8 |
| Granada, ES | 8 |
| Porrentruy, CH | 7 |
| Alicante, ES | 7 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 7 |
| Gijón, ES | 6 |
| Oskarshamn, SE | 6 |
| PRClocation not on record | 6 |
| Frankfurt am Main | 6 |
| Dresden, DE | 6 |
| Bourges, FR | 6 |
| Helsinki, FI | 5 |
| Paris, FR | 4 |
| Salzburg, AT | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Bronx, US | 4 |
| DBF-NHMDlocation not on record | 4 |
| SZUlocation not on record | 4 |
| SLU Artdatabankenlocation not on record | 4 |
| Santiago de Compostela, ES | 3 |
| BIO-UNIPIlocation not on record | 3 |
| Denver, US | 3 |
| Saint Louis, US | 2 |
| GZUlocation not on record | 2 |
| Pamplona, ES | 2 |
| RABATlocation not on record | 2 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 2 |
| Tallinn, EE | 2 |
| CICYTEXlocation not on record | 2 |
| Fulda, DE | 2 |
| MeiseBGlocation not on record | 2 |
| OLAlocation not on record | 2 |
| Uppsala, SE | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| Sevilla, ES | 1 |
| JBCLMlocation not on record | 1 |
| Kew, GB | 1 |
| Monastir, TN | 1 |
| Brookings, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Martin-Luther-Universität Halle-Wittenberglocation not on record | 1 |
| Banyoles, ES | 1 |
| Nijmegen, NL | 1 |
| EEZA-CSIClocation not on record | 1 |
| Taipei, TW | 1 |
| Arequipa, PE | 1 |
| Turku, FI | 1 |
| Oulu, FI | 1 |
| POL003location not on record | 1 |
| Pamplona, ES | 1 |
| Bratislava, SK | 1 |
| IPE-CSIClocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Coimbra, PT | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Tilburg, NL | 1 |
| Beijing, CN | 1 |
| ULBF-AGRlocation not on record | 1 |
| Wellington, NZ | 1 |
| Tuscaloosa, US | 1 |
| Tartu, EE | 1 |
94 institutions · 1 210 of 1 278 vouchered records shown · 39 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA21 detections
Where the DNA of Alyssum montanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found21
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 21 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.8 °C 5.50–14.3
Seasonal swing summer↔winter20.8 °C
Max temp (day)16.2 °C 9.00–17.9
Min temp (night)6.50 °C 0–9.30
Precipitation81.3 mm/mo 42.0–290
Air humidity61.3 % 56.0–62.6
Moisture balance8.50 mm/mo -35.1–212
Vapour deficit590 Pa 397–789
Wind speed1.80 m/s 0.8–3.30
Cloud cover42.1 % 38.1–44.2
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.