Alysson tricolor

Lepeletier & Audinet-Serville, 1825 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Crabronidae/Alysson

At a glance

Occurrence records61

Data sources6

Biological traits0

DNA specimens6

eDNA detections5

Sources6 archives

Databases and archives Alysson tricolor's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF61 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Weibchen mit erbeuteter Orientzikade Alysson tricolor ist ein Hautflügler aus der Familie der Crabronidae. Sie ist in Europa eine von sechs Arten der Gattung Alysson. Die ursprünglich südeuropäische Grabwespen-Art hat sich offenbar in den letzten Jahren an verschiedenen Standorten in Deutschland etabliert. Das lateinische Art-Epitheton tricolor bedeutet „dreifarbig“ und bezieht sich auf die Färbung des Weibchens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alysson tricolor has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Diversity (π)7.1%

Haplotypes1

BIN1

Where individuals differ — all 92 variable positions, in barcode order

476Tmostly conserved

478Amostly conserved

479Amostly conserved

481Amostly conserved

482Gmostly conserved

483Amostly conserved

484Tmostly conserved

485Tmostly conserved

488Amostly conserved

489Tmostly conserved

490Amostly conserved

491Cmostly conserved

492Cmostly conserved

494Tmostly conserved

497Tmostly conserved

498Tmostly conserved

499Tmostly conserved

500Gmostly conserved

502Tmostly conserved

504Gmostly conserved

505Amostly conserved

506Tmostly conserved

507Cmostly conserved

508Amostly conserved

509Amostly conserved

510Tmostly conserved

511Tmostly conserved

513Tmostly conserved

514Tmostly conserved

518Amostly conserved

519Cmostly conserved

522Cmostly conserved

523Amostly conserved

525Tmostly conserved

527Tmostly conserved

528Tmostly conserved

530Cmostly conserved

536Tmostly conserved

538Amostly conserved

539Gmostly conserved

540Cmostly conserved

541Tmostly conserved

542Gmostly conserved

545Cmostly conserved

550Tmostly conserved

552Tmostly conserved

553Amostly conserved

555Cmostly conserved

556Amostly conserved

557Gmostly conserved

558Gmostly conserved

563Amostly conserved

564Tmostly conserved

565Tmostly conserved

566Amostly conserved

568Tmostly conserved

571Amostly conserved

572Cmostly conserved

573Tmostly conserved

575Tmostly conserved

578Amostly conserved

579Cmostly conserved

581Gmostly conserved

582Amostly conserved

583Tmostly conserved

584Cmostly conserved

585Gmostly conserved

586Amostly conserved

587Amostly conserved

590Tmostly conserved

591Tmostly conserved

596Amostly conserved

597Cmostly conserved

599Tmostly conserved

600Cmostly conserved

601Amostly conserved

602Tmostly conserved

603Tmostly conserved

604Cmostly conserved

606Tmostly conserved

607Tmostly conserved

608Gmostly conserved

609Amostly conserved

610Tmostly conserved

611Cmostly conserved

612Cmostly conserved

614Amostly conserved

617Gmostly conserved

618Gmostly conserved

619Amostly conserved

620Gmostly conserved

621Gmostly conserved

AATACTATATTTTATTTTTGCATTTTACTCAGGAATAATCGGATCCTCTTTAAGAATACTAATTCGAATAGAATTAGGATTTCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alysson spinosussame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor40

Museum / vouchered21

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 20≤1 km 8≤10 km 5>10 km 3

36 georeferenced · 4 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 17

18 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	12
Provincia di Livornolocation not on record	4
Philadelphia, US	1

3 institutions · 17 of 21 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Alysson tricolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 18.4–19.6

Seasonal swing summer↔winter20.2 °C

Max temp (day)24.0 °C 22.9–24.0

Min temp (night)14.6 °C 12.9–14.6

Precipitation97.7 mm/mo 82.6–97.7

Air humidity58.0 % 57.2–58.0

Moisture balance-39.7 mm/mo -55.4–-38.7

Vapour deficit957 Pa 909–957

Wind speed2.60 m/s 2.20–3.10

Cloud cover30.9 % 29.5–34.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)